Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7296Btlr/Mmmh
Stock Number:
045400-MU
Citation ID:
RRID:MMRRC_045400-MU
Other Names:
R7296 (G1)
Major Collection:

Strain Information

Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
B4galt6
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56386
VEGA: 18
HGNC: HGNC:929
Homologene: 3506
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Hgf
Name: hepatocyte growth factor
Synonyms: scatter factor, NK1, SF/HGF, HGF/SF, NK2, C230052L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15234
HGNC: HGNC:4893
Homologene: 503
Kcnj5
Name: potassium inwardly-rectifying channel, subfamily J, member 5
Synonyms: Kir3.4, GIRK4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16521
VEGA: 9
HGNC: HGNC:6266
Homologene: 20248
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Zmynd8
Name: zinc finger, MYND-type containing 8
Synonyms: 1110013E22Rik, 2010005I16Rik, ZMYND8, RACK7, 3632413B07Rik, Prkcbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228880
HGNC: HGNC:9397
Homologene: 32679
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Cdyl
Name: chromodomain protein, Y chromosome-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12593
VEGA: 13
HGNC: HGNC:1811
Homologene: 3548
Aplf
Name: aprataxin and PNKP like factor
Synonyms: 2010301N04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72103
Homologene: 49753
Hectd1
Name: HECT domain E3 ubiquitin protein ligase 1
Synonyms: A630086P08Rik, opm, b2b327Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 207304
VEGA: 12
Homologene: 9115
Ankle2
Name: ankyrin repeat and LEM domain containing 2
Synonyms: 1110001J12Rik, D5Ertd585e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71782
Homologene: 35424
Ptpn1
Name: protein tyrosine phosphatase, non-receptor type 1
Synonyms: PTP-1B, PTP1B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19246
HGNC: HGNC:9642
Homologene: 2119
Niban2
Name: niban apoptosis regulator 2
Synonyms: 9130404D14Rik, Fam129b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227737
Homologene: 11269
Fgd6
Name: FYVE, RhoGEF and PH domain containing 6
Synonyms: ZFYVE24, Etohd4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13998
Homologene: 14209
L3mbtl3
Name: L3MBTL3 histone methyl-lysine binding protein
Synonyms: MBT-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237339
Homologene: 18226
Slc7a6os
Name: solute carrier family 7, member 6 opposite strand
Synonyms: 2010007L18Rik, 2400002F02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66432
Homologene: 41853
Ric1
Name: RAB6A GEF complex partner 1
Synonyms: C130057E09Rik, C030046E11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226089
Homologene: 13806
Abhd5
Name: abhydrolase domain containing 5
Synonyms: NCIE2, IECN5, 1300003D03Rik, 2010002J10Rik, CGI-58
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67469
Homologene: 41088
Robo1
Name: roundabout guidance receptor 1
Synonyms: DUTT1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19876
Homologene: 2206
Icam1
Name: intercellular adhesion molecule 1
Synonyms: CD54, MALA-2, Icam-1, Ly-47
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15894
VEGA: 9
HGNC: HGNC:5344
Homologene: 168
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Atp5f1b
Name: ATP synthase F1 subunit beta
Synonyms: Atp5b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11947
HGNC: HGNC:830
Homologene: 1273
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329559
Homologene: 11129
Cux2
Name: cut-like homeobox 2
Synonyms: Cux-2, Cux2, ENSMUSG00000072641, Cutl2, 1700051K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13048
Homologene: 22426
Colec11
Name: collectin sub-family member 11
Synonyms: 1010001H16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71693
VEGA: 12
Homologene: 11423
Epha6
Name: Eph receptor A6
Synonyms: m-ehk2, Ehk2, Hek12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13840
Homologene: 56396
Rpn1
Name: ribophorin I
Synonyms: Rpn-1, D6Wsu137e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 103963
Homologene: 2213
Zfp54
Name: zinc finger protein 54
Synonyms: clone 18, KRAB10, Zfp-54, Zfp76
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22712
Homologene: 129791
Metap1d
Name: methionyl aminopeptidase type 1D (mitochondrial)
Synonyms: 2310066F24Rik, 3110033D18Rik, Metapl1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66559
Homologene: 11987
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Tepsin
Name: TEPSIN, adaptor related protein complex 4 accessory protein
Synonyms: 2410002I01Rik, Enthd2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78777
Homologene: 35359
Wdr6
Name: WD repeat domain 6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83669
Homologene: 117682
Phf21b
Name: PHD finger protein 21B
Synonyms: A730032D07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 271305
Homologene: 78154
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Dnmt3c
Name: DNA methyltransferase 3C
Synonyms: Gm14490, Dnmt3c-ps, Dnmt3b-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668932
Rai1
Name: retinoic acid induced 1
Synonyms: Gt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19377
HGNC: HGNC:9834
Homologene: 7508
Dock8
Name: dedicator of cytokinesis 8
Synonyms: 1200017A24Rik, 5830472H07Rik, A130095G14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76088
VEGA: 19
Homologene: 52414
Itga2
Name: integrin alpha 2
Synonyms: VLA-2 receptor, alpha 2 subunit, CD49B, DX5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16398
VEGA: 13
HGNC: HGNC:6137
Homologene: 1662
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Megf10
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70417
Homologene: 23771
Cracdl
Name: capping protein inhibiting regulator of actin like
Synonyms: 2010300C02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72097
Homologene: 19208
Ccdc168
Name: coiled-coil domain containing 168
Synonyms: Gm8251
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102636082
VEGA: 1
Homologene: 141149
Abcc9
Name: ATP-binding cassette, sub-family C member 9
Synonyms: SUR2B, SUR2A, Sur2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20928
HGNC: HGNC:60
Homologene: 56521
Bmal2
Name: basic helix-loop-helix ARNT like 2
Synonyms: 4632430A05Rik, MOP9, bHLHe6, Arntl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 272322
Homologene: 10609
Nlrc3
Name: NLR family, CARD domain containing 3
Synonyms: D230007K08Rik, Caterpiller 16.2, CLR16.2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268857
Homologene: 18720
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Zdhhc8
Name: zinc finger, DHHC domain containing 8
Synonyms: D16H22S1738E, E330009O14Rik, Op53c05
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27801
VEGA: 16
Homologene: 8363
Serpinb1b
Name: serine (or cysteine) peptidase inhibitor, clade B, member 1b
Synonyms: 6330533H24Rik, ovalbumin, EIB
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 282663
HGNC: HGNC:3311
Homologene: 138408
Adam6a
Name: a disintegrin and metallopeptidase domain 6A
Synonyms: Adam6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238406
HGNC: HGNC:213
Homologene: 128362
Mfap5
Name: microfibrillar associated protein 5
Synonyms: MAGP-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50530
Homologene: 2599
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Klra17
Name: killer cell lectin-like receptor, subfamily A, member 17
Synonyms: Ly49q1, Ly-49Q, Ly49Q
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170733
Eri2
Name: exoribonuclease 2
Synonyms: 4933424N09Rik, Exod1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71151
Homologene: 12383
Pde6a
Name: phosphodiesterase 6A, cGMP-specific, rod, alpha
Synonyms: Pdea
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225600
HGNC: HGNC:8785
Homologene: 380
Prob1
Name: proline rich basic protein 1
Synonyms: LOC381148, Gm1614
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381148
Homologene: 83773
Vmn1r201
Name: vomeronasal 1 receptor 201
Synonyms: V1ri4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171255
Homologene: 110880
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: Casr-rs3, EG637898, Gprc2a-rs3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Prss50
Name: serine protease 50
Synonyms: Tsp50
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235631
Homologene: 8314
Slc35c1
Name: solute carrier family 35, member C1
Synonyms: FUCT1, E430007K15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228368
Homologene: 41258
Cables2
Name: CDK5 and Abl enzyme substrate 2
Synonyms: ik3-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 252966
Homologene: 45440
Setd4
Name: SET domain containing 4
Synonyms: ORF21
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224440
HGNC: HGNC:1258
Homologene: 41173
Tas2r144
Name: taste receptor, type 2, member 144
Synonyms: mt2r33, Tas2r44
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387515
Homologene: 47977
Fkbp7
Name: FK506 binding protein 7
Synonyms: FKBP23
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14231
HGNC: HGNC:3723
Homologene: 22568
Fbxw22
Name: F-box and WD-40 domain protein 22
Synonyms: Gm5164
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382156
Homologene: 110776
Or10ag59
Name: olfactory receptor family 10 subfamily AG member 59
Synonyms: GA_x6K02T2Q125-49078087-49079031, MOR264-23, MOR264-9P, Olfr1129
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258111
Homologene: 133705
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Mixl1
Name: Mix paired-like homeobox
Synonyms: Mml
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27217
Homologene: 8445
Asic5
Name: acid-sensing ion channel family member 5
Synonyms: brain-liver-intestine amiloride-sensitive sodium channel, BLINaC, Accn5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 58170
Homologene: 41171
Clip4
Name: CAP-GLY domain containing linker protein family, member 4
Synonyms: 1700074B05Rik, 5830409B12Rik, 4833417L20Rik, 1700024K14Rik, Rsnl2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78785
VEGA: 17
Homologene: 11662
4921524L21Rik
Name: RIKEN cDNA 4921524L21 gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70901
VEGA: 18
Homologene: 78009
Cyp2d34
Name: cytochrome P450, family 2, subfamily d, polypeptide 34
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223706
VEGA: 15
Homologene: 86099
Pcna
Name: proliferating cell nuclear antigen
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18538
HGNC: HGNC:8729
Homologene: 1945
Nutm1
Name: NUT midline carcinoma, family member 1
Synonyms: Nut, BC125332
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 213765
Homologene: 18185
Or12j2
Name: olfactory receptor family 12 subfamily J member 2
Synonyms: GA_x6K02T2PBJ9-42486061-42486978, MOR251-5, Olfr527
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257939
Homologene: 73958
A4gnt
Name: alpha-1,4-N-acetylglucosaminyltransferase
Synonyms: LOC333424, alpha4GnT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 333424
Homologene: 87446
1700066M21Rik
Name: RIKEN cDNA 1700066M21 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73467
Homologene: 13624
Fam43b
Name: family with sequence similarity 43, member B
Synonyms: OTTMUSG00000009974
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 625638
Homologene: 45810
Or4c117
Name: olfactory receptor family 4 subfamily C member 117
Synonyms: GA_x6K02T2Q125-50604368-50603433, MOR233-14, Olfr1222
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258177
Homologene: 73988
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 37,614,618 bp
  • T to A, chromosome 1 at 44,060,916 bp
  • T to A, chromosome 1 at 57,383,143 bp
  • T to A, chromosome 1 at 60,310,224 bp
  • T to C, chromosome 1 at 90,827,986 bp
  • T to C, chromosome 1 at 180,696,958 bp
  • T to C, chromosome 2 at 32,922,642 bp
  • T to A, chromosome 2 at 69,482,381 bp
  • G to C, chromosome 2 at 71,506,785 bp
  • G to T, chromosome 2 at 76,671,764 bp
  • T to A, chromosome 2 at 87,575,708 bp
  • C to A, chromosome 2 at 89,124,836 bp
  • C to A, chromosome 2 at 92,458,739 bp
  • G to A, chromosome 2 at 112,250,056 bp
  • A to G, chromosome 2 at 132,252,877 bp
  • A to G, chromosome 2 at 153,715,026 bp
  • A to G, chromosome 2 at 164,900,132 bp
  • T to C, chromosome 2 at 165,840,009 bp
  • T to C, chromosome 2 at 167,974,772 bp
  • A to G, chromosome 2 at 180,260,336 bp
  • C to A, chromosome 3 at 38,889,145 bp
  • C to T, chromosome 3 at 82,021,076 bp
  • A to G, chromosome 4 at 129,225,418 bp
  • A to G, chromosome 4 at 138,395,841 bp
  • T to A, chromosome 5 at 16,564,843 bp
  • G to A, chromosome 5 at 110,237,724 bp
  • T to C, chromosome 5 at 121,861,256 bp
  • A to C, chromosome 6 at 42,215,439 bp
  • A to G, chromosome 6 at 84,106,898 bp
  • G to A, chromosome 6 at 87,646,215 bp
  • A to G, chromosome 6 at 88,084,637 bp
  • T to G, chromosome 6 at 113,147,557 bp
  • T to A, chromosome 6 at 122,528,422 bp
  • T to A, chromosome 6 at 129,831,592 bp
  • G to A, chromosome 6 at 142,671,593 bp
  • G to A, chromosome 6 at 146,822,134 bp
  • T to A, chromosome 7 at 42,136,402 bp
  • A to T, chromosome 7 at 119,786,516 bp
  • G to A, chromosome 7 at 120,278,311 bp
  • A to G, chromosome 7 at 131,112,132 bp
  • A to T, chromosome 7 at 140,336,741 bp
  • G to T, chromosome 8 at 106,210,489 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to C, chromosome 9 at 21,019,015 bp
  • A to C, chromosome 9 at 32,322,749 bp
  • T to C, chromosome 9 at 79,682,066 bp
  • T to G, chromosome 9 at 99,620,282 bp
  • G to T, chromosome 9 at 108,574,585 bp
  • C to A, chromosome 9 at 109,382,075 bp
  • A to G, chromosome 9 at 110,861,289 bp
  • G to A, chromosome 9 at 122,379,573 bp
  • T to A, chromosome 10 at 26,282,830 bp
  • T to A, chromosome 10 at 82,061,237 bp
  • A to G, chromosome 10 at 88,770,724 bp
  • T to A, chromosome 10 at 94,044,047 bp
  • C to A, chromosome 10 at 94,139,881 bp
  • T to C, chromosome 10 at 128,085,522 bp
  • G to A, chromosome 11 at 60,188,673 bp
  • G to T, chromosome 11 at 120,091,708 bp
  • T to A, chromosome 12 at 28,594,715 bp
  • C to T, chromosome 12 at 51,785,852 bp
  • T to A, chromosome 12 at 76,103,036 bp
  • T to C, chromosome 12 at 79,278,372 bp
  • C to T, chromosome 12 at 113,545,572 bp
  • C to T, chromosome 13 at 22,475,339 bp
  • A to T, chromosome 13 at 33,093,827 bp
  • A to G, chromosome 13 at 35,863,395 bp
  • G to T, chromosome 13 at 68,568,860 bp
  • A to C, chromosome 13 at 114,857,394 bp
  • T to C, chromosome 14 at 54,990,025 bp
  • G to T, chromosome 15 at 82,617,235 bp
  • A to T, chromosome 15 at 84,855,717 bp
  • T to A, chromosome 15 at 101,850,629 bp
  • T to C, chromosome 16 at 3,963,590 bp
  • T to C, chromosome 16 at 18,234,926 bp
  • T to A, chromosome 16 at 59,915,838 bp
  • C to T, chromosome 16 at 72,989,631 bp
  • T to C, chromosome 16 at 93,583,942 bp
  • T to A, chromosome 17 at 21,433,582 bp
  • A to G, chromosome 17 at 34,743,659 bp
  • T to C, chromosome 17 at 71,790,001 bp
  • T to G, chromosome 18 at 6,626,385 bp
  • A to T, chromosome 18 at 20,728,042 bp
  • A to G, chromosome 18 at 35,653,299 bp
  • A to T, chromosome 18 at 57,275,753 bp
  • A to G, chromosome 18 at 61,258,293 bp
  • T to A, chromosome 19 at 25,184,881 bp
  • G to A, chromosome 19 at 29,584,578 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7296 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045400-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.