Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7301Btlr/Mmmh
Stock Number:
045405-MU
Citation ID:
RRID:MMRRC_045405-MU
Other Names:
R7301 (G1)
Major Collection:

Strain Information

Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: fatty acid transport protein 4, FATP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Frrs1
Name: ferric-chelate reductase 1
Synonyms: Sdfr2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20321
Homologene: 40653
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Cd2ap
Name: CD2-associated protein
Synonyms: METS-1, Mets1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 75,136,424 bp
  • T to C, chromosome 2 at 22,544,466 bp
  • T to A, chromosome 2 at 25,400,909 bp
  • C to T, chromosome 2 at 29,812,932 bp
  • T to G, chromosome 2 at 32,096,055 bp
  • T to A, chromosome 2 at 36,688,011 bp
  • T to A, chromosome 2 at 101,717,286 bp
  • T to C, chromosome 3 at 116,895,563 bp
  • T to C, chromosome 3 at 118,899,284 bp
  • A to C, chromosome 3 at 123,114,053 bp
  • T to A, chromosome 4 at 33,095,284 bp
  • T to C, chromosome 4 at 42,792,923 bp
  • G to A, chromosome 4 at 58,046,587 bp
  • T to A, chromosome 4 at 117,052,822 bp
  • C to A, chromosome 4 at 128,528,262 bp
  • T to C, chromosome 4 at 147,986,323 bp
  • A to T, chromosome 5 at 117,867,905 bp
  • A to G, chromosome 5 at 122,352,614 bp
  • T to A, chromosome 5 at 146,539,547 bp
  • G to T, chromosome 6 at 31,524,436 bp
  • A to T, chromosome 6 at 40,329,517 bp
  • T to C, chromosome 6 at 108,542,024 bp
  • T to C, chromosome 6 at 118,511,663 bp
  • C to A, chromosome 7 at 3,415,421 bp
  • A to G, chromosome 7 at 5,125,740 bp
  • C to A, chromosome 7 at 19,394,135 bp
  • A to G, chromosome 7 at 21,319,053 bp
  • T to A, chromosome 7 at 24,990,515 bp
  • T to A, chromosome 7 at 28,093,436 bp
  • A to G, chromosome 7 at 48,198,758 bp
  • G to A, chromosome 7 at 119,777,085 bp
  • G to T, chromosome 7 at 126,494,211 bp
  • A to G, chromosome 8 at 70,813,699 bp
  • A to G, chromosome 8 at 107,392,648 bp
  • G to T, chromosome 9 at 107,914,790 bp
  • G to T, chromosome 9 at 109,054,884 bp
  • T to A, chromosome 9 at 121,145,059 bp
  • C to A, chromosome 9 at 123,260,301 bp
  • T to C, chromosome 10 at 43,936,020 bp
  • C to A, chromosome 10 at 61,696,549 bp
  • C to G, chromosome 10 at 76,038,703 bp
  • T to C, chromosome 10 at 93,492,561 bp
  • G to T, chromosome 10 at 100,447,474 bp
  • T to C, chromosome 10 at 129,111,699 bp
  • A to T, chromosome 11 at 30,117,798 bp
  • A to T, chromosome 11 at 60,748,148 bp
  • A to T, chromosome 11 at 65,828,225 bp
  • G to T, chromosome 11 at 75,510,116 bp
  • A to C, chromosome 11 at 98,152,808 bp
  • A to T, chromosome 12 at 79,282,984 bp
  • A to G, chromosome 12 at 103,419,450 bp
  • A to T, chromosome 12 at 115,312,295 bp
  • G to A, chromosome 13 at 22,556,805 bp
  • C to A, chromosome 13 at 23,357,143 bp
  • C to T, chromosome 13 at 23,357,144 bp
  • T to C, chromosome 13 at 24,725,001 bp
  • T to C, chromosome 13 at 40,721,308 bp
  • T to A, chromosome 13 at 89,705,266 bp
  • T to C, chromosome 14 at 15,357,934 bp
  • T to C, chromosome 14 at 27,076,391 bp
  • G to A, chromosome 15 at 58,322,980 bp
  • C to A, chromosome 15 at 89,355,530 bp
  • T to C, chromosome 15 at 99,278,748 bp
  • T to C, chromosome 16 at 97,056,532 bp
  • A to G, chromosome 17 at 20,345,616 bp
  • G to A, chromosome 17 at 42,830,013 bp
  • A to G, chromosome 17 at 85,431,493 bp
  • C to G, chromosome 18 at 10,544,970 bp
  • G to A, chromosome 18 at 36,946,924 bp
  • G to T, chromosome 18 at 53,340,172 bp
  • T to A, chromosome 19 at 24,477,124 bp
  • T to A, chromosome 19 at 24,477,346 bp
  • TCGGGGCCGGGGCCGGGGCCG to TCGGGGCCGGGGCCGGGGCCGGGGCCG, chromosome X at 101,794,171 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7301 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045405-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.