Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7301Btlr/Mmmh
Stock Number:
045405-MU
Citation ID:
RRID:MMRRC_045405-MU
Other Names:
R7301 (G1)
Major Collection:

Strain Information

Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: fatty acid transport protein 4, FATP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Frrs1
Name: ferric-chelate reductase 1
Synonyms: Sdfr2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20321
Homologene: 40653
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Cd2ap
Name: CD2-associated protein
Synonyms: METS-1, Mets1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Il17rd
Name: interleukin 17 receptor D
Synonyms: Sef, Sef-S, 2810004A10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 171463
VEGA: 14
Homologene: 9717
Atxn2l
Name: ataxin 2-like
Synonyms: A2RP, A2LG, A2D, A2lp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233871
Homologene: 16513
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Itpr-1, Ip3r, Pcp-1, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Camkmt
Name: calmodulin-lysine N-methyltransferase
Synonyms: 1700106N22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73582
VEGA: 17
Homologene: 11704
Agk
Name: acylglycerol kinase
Synonyms: MuLK, 2610037M15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69923
Homologene: 41239
Tmtc3
Name: transmembrane and tetratricopeptide repeat containing 3
Synonyms: 9130014E20Rik, B130008E12Rik, mSmile
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237500
Homologene: 27616
Tfap2a
Name: transcription factor AP-2, alpha
Synonyms: Ap-2 (a), AP-2 alpha, Ap2tf, Ap2, Tcfap2a, AP2alpha
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21418
VEGA: 13
Homologene: 2421
Ripor2
Name: RHO family interacting cell polarization regulator 2
Synonyms: 1700108N18Rik, E430013J17Rik, 6330500D04Rik, Fam65b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 193385
Homologene: 9284
Top3a
Name: topoisomerase (DNA) III alpha
Synonyms: Top IIIa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21975
Homologene: 3394
Eif2b3
Name: eukaryotic translation initiation factor 2B, subunit 3
Synonyms: 1190002P15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 108067
HGNC: HGNC:3259
Homologene: 7005
Ddx24
Name: DEAD box helicase 24
Synonyms: 1700055J08Rik, 2510027P10Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 24
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27225
VEGA: 12
Homologene: 10702
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232339
Homologene: 45968
Zfyve26
Name: zinc finger, FYVE domain containing 26
Synonyms: 9330197E15Rik, LOC380767, A630028O16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211978
VEGA: 12
Homologene: 9102
Mst1r
Name: macrophage stimulating 1 receptor (c-met-related tyrosine kinase)
Synonyms: STK, Fv-2, Ron, CDw136, friend virus susceptibility 2, PTK8, Fv2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19882
HGNC: HGNC:7381
Homologene: 1835
Zfp280b
Name: zinc finger protein 280B
Synonyms: D10Jhu82e, Suhw2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64453
VEGA: 10
Homologene: 62794
Il12rb1
Name: interleukin 12 receptor, beta 1
Synonyms: IL-12R[b], CD212
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16161
HGNC: HGNC:5971
Homologene: 4042
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Rtn4ip1
Name: reticulon 4 interacting protein 1
Synonyms: NIMP, D10Ertd690e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 170728
Homologene: 13105
Myo3a
Name: myosin IIIA
Synonyms: 9030416P08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 667663
HGNC: HGNC:7601
Homologene: 49486
Dpyd
Name: dihydropyrimidine dehydrogenase
Synonyms: DPD, E330028L06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99586
HGNC: HGNC:3012
Homologene: 85
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Ighv1-58
Name: immunoglobulin heavy variable 1-58
Synonyms: Gm16633
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780939
Rad9b
Name: RAD9 checkpoint clamp component B
Synonyms: A630082N15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231724
Homologene: 17006
Vmn1r204
Name: vomeronasal 1 receptor 204
Synonyms: Gm11301
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 632793
Homologene: 110880
Ulk4
Name: unc-51-like kinase 4
Synonyms: 4932415A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209012
Homologene: 41205
Hal
Name: histidine ammonia lyase
Synonyms: histidase, Hsd
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15109
HGNC: HGNC:4806
Homologene: 68229
Synpo2
Name: synaptopodin 2
Synonyms: myopodin, Myo, 1110069I04Rik, 9530006G20Rik, 2310068J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 118449
Homologene: 15400
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Or1j17
Name: olfactory receptor family 1 subfamily J member 17
Synonyms: GA_x6K02T2NLDC-33382467-33383396, MOR136-11, Olfr346
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258940
Homologene: 133616
Zkscan6
Name: zinc finger with KRAB and SCAN domains 6
Synonyms: 1700128E15Rik, KOX11, D11Ertd714e, Zfp535
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52712
Homologene: 12119
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Rilp
Name: Rab interacting lysosomal protein
Synonyms: LOC333615
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 280408
Homologene: 19596
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Cnppd1
Name: cyclin Pas1/PHO80 domain containing 1
Synonyms: 1810031K17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69171
Homologene: 9238
Vmn2r107
Name: vomeronasal 2, receptor 107
Synonyms: V2r6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22312
Homologene: 129750
Ercc2
Name: excision repair cross-complementing rodent repair deficiency, complementation group 2
Synonyms: XPD, Ercc-2, RCO015, Mhdarco15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13871
HGNC: HGNC:3434
Homologene: 344
Lrrc3b
Name: leucine rich repeat containing 3B
Synonyms: LRP15
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218763
VEGA: 14
Homologene: 14190
Acsm3
Name: acyl-CoA synthetase medium-chain family member 3
Synonyms: Sa, Sah
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20216
Homologene: 74559
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Or6c2b
Name: olfactory receptor family 6 subfamily C member 2B
Synonyms: GA_x6K02T2PULF-10797876-10796938, MOR114-14, Olfr769
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257667
Homologene: 121502
Prr5l
Name: proline rich 5 like
Synonyms: 4833411O04Rik, 2600010E01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72446
Homologene: 11753
Mrgprb4
Name: MAS-related GPR, member B4
Synonyms: MrgB4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233230
Homologene: 115575
Cacng8
Name: calcium channel, voltage-dependent, gamma subunit 8
Synonyms: TARP gamma 8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81905
Homologene: 12894
Gabrr2
Name: gamma-aminobutyric acid type A receptor subunit rho 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14409
HGNC: HGNC:4091
Homologene: 20471
Entpd2
Name: ectonucleoside triphosphate diphosphohydrolase 2
Synonyms: NTPDase2, Cd39l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12496
HGNC: HGNC:3364
Homologene: 20333
Zfp322a
Name: zinc finger protein 322A
Synonyms: 9630054P07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218100
Homologene: 23460
Rasl2-9
Name: RAS-like, family 2, locus 9
Synonyms: Ran/M2, Rasl2-9-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19428
HGNC: HGNC:9846
Homologene: 135303
Snx24
Name: sorting nexing 24
Synonyms: 2810011K15Rik, 5730433I16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69226
VEGA: 18
Homologene: 8529
Tmem158
Name: transmembrane protein 158
Synonyms: 2310037P21Rik, Ris1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72309
VEGA: 9
Homologene: 9141
Lmf2
Name: lipase maturation factor 2
Synonyms: Tmem153, Tmem112b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105847
VEGA: 15
Homologene: 11251
Shisa5
Name: shisa family member 5
Synonyms: 2310008D10Rik, 6430628I05Rik, Scotin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66940
Homologene: 133951
Podxl
Name: podocalyxin-like
Synonyms: Pclp1, Ly102, PC, podocalyxin, Podxl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27205
HGNC: HGNC:9171
Homologene: 137260
Nppb
Name: natriuretic peptide type B
Synonyms: BNP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18158
HGNC: HGNC:7940
Homologene: 49182
Klhl38
Name: kelch-like 38
Synonyms: 8230402K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268807
Homologene: 18622
Nqo1
Name: NAD(P)H dehydrogenase, quinone 1
Synonyms: NMO1, NQO1, QR1, NAD(P)H dehydrogenase (quinone), Ox-1, Ox1, Nmor1, Dia4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18104
HGNC: HGNC:2874
Homologene: 695
Plpp7
Name: phospholipid phosphatase 7 (inactive)
Synonyms: D830019K17Rik, NET39, Ppapdc3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227721
Homologene: 41885
Tysnd1
Name: trypsin domain containing 1
Synonyms: 1300019N10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71767
VEGA: 10
Homologene: 87946
Pcdha3
Name: protocadherin alpha 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192163
HGNC: HGNC:8669
Homologene: 129613
Vmn1r127
Name: vomeronasal 1 receptor 127
Synonyms: Gm6239
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 621561
Homologene: 104166
Pabir1
Name: PP2A A alpha (PPP2R1A) and B55A (PPP2R2A) interacting phosphatase regulator 1
Synonyms: 2410124L17Rik, 2900009I07Rik, Gm9849, Fam122a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68034
VEGA: 19
Homologene: 75240
Spata31f1e
Name: spermatogenesis associated 31 subfamily F member 1E
Synonyms: Gm12394
Type: Gene
Species: Mouse
Chromosome: 4
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 75,136,424 bp
  • T to C, chromosome 2 at 22,544,466 bp
  • T to A, chromosome 2 at 25,400,909 bp
  • C to T, chromosome 2 at 29,812,932 bp
  • T to G, chromosome 2 at 32,096,055 bp
  • T to A, chromosome 2 at 36,688,011 bp
  • T to A, chromosome 2 at 101,717,286 bp
  • T to C, chromosome 3 at 116,895,563 bp
  • T to C, chromosome 3 at 118,899,284 bp
  • A to C, chromosome 3 at 123,114,053 bp
  • T to A, chromosome 4 at 33,095,284 bp
  • T to C, chromosome 4 at 42,792,923 bp
  • G to A, chromosome 4 at 58,046,587 bp
  • T to A, chromosome 4 at 117,052,822 bp
  • C to A, chromosome 4 at 128,528,262 bp
  • T to C, chromosome 4 at 147,986,323 bp
  • A to T, chromosome 5 at 117,867,905 bp
  • A to G, chromosome 5 at 122,352,614 bp
  • T to A, chromosome 5 at 146,539,547 bp
  • G to T, chromosome 6 at 31,524,436 bp
  • A to T, chromosome 6 at 40,329,517 bp
  • T to C, chromosome 6 at 108,542,024 bp
  • T to C, chromosome 6 at 118,511,663 bp
  • C to A, chromosome 7 at 3,415,421 bp
  • A to G, chromosome 7 at 5,125,740 bp
  • C to A, chromosome 7 at 19,394,135 bp
  • A to G, chromosome 7 at 21,319,053 bp
  • T to A, chromosome 7 at 24,990,515 bp
  • T to A, chromosome 7 at 28,093,436 bp
  • A to G, chromosome 7 at 48,198,758 bp
  • G to A, chromosome 7 at 119,777,085 bp
  • G to T, chromosome 7 at 126,494,211 bp
  • A to G, chromosome 8 at 70,813,699 bp
  • A to G, chromosome 8 at 107,392,648 bp
  • G to T, chromosome 9 at 107,914,790 bp
  • G to T, chromosome 9 at 109,054,884 bp
  • T to A, chromosome 9 at 121,145,059 bp
  • C to A, chromosome 9 at 123,260,301 bp
  • T to C, chromosome 10 at 43,936,020 bp
  • C to A, chromosome 10 at 61,696,549 bp
  • C to G, chromosome 10 at 76,038,703 bp
  • T to C, chromosome 10 at 93,492,561 bp
  • G to T, chromosome 10 at 100,447,474 bp
  • T to C, chromosome 10 at 129,111,699 bp
  • A to T, chromosome 11 at 30,117,798 bp
  • A to T, chromosome 11 at 60,748,148 bp
  • A to T, chromosome 11 at 65,828,225 bp
  • G to T, chromosome 11 at 75,510,116 bp
  • A to C, chromosome 11 at 98,152,808 bp
  • A to T, chromosome 12 at 79,282,984 bp
  • A to G, chromosome 12 at 103,419,450 bp
  • A to T, chromosome 12 at 115,312,295 bp
  • G to A, chromosome 13 at 22,556,805 bp
  • C to A, chromosome 13 at 23,357,143 bp
  • C to T, chromosome 13 at 23,357,144 bp
  • T to C, chromosome 13 at 24,725,001 bp
  • T to C, chromosome 13 at 40,721,308 bp
  • T to A, chromosome 13 at 89,705,266 bp
  • T to C, chromosome 14 at 15,357,934 bp
  • T to C, chromosome 14 at 27,076,391 bp
  • G to A, chromosome 15 at 58,322,980 bp
  • C to A, chromosome 15 at 89,355,530 bp
  • T to C, chromosome 15 at 99,278,748 bp
  • T to C, chromosome 16 at 97,056,532 bp
  • A to G, chromosome 17 at 20,345,616 bp
  • G to A, chromosome 17 at 42,830,013 bp
  • A to G, chromosome 17 at 85,431,493 bp
  • C to G, chromosome 18 at 10,544,970 bp
  • G to A, chromosome 18 at 36,946,924 bp
  • G to T, chromosome 18 at 53,340,172 bp
  • T to A, chromosome 19 at 24,477,124 bp
  • T to A, chromosome 19 at 24,477,346 bp
  • TCGGGGCCGGGGCCGGGGCCG to TCGGGGCCGGGGCCGGGGCCGGGGCCG, chromosome X at 101,794,171 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7301 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045405-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.