Strain Name:
C57BL/6J-MtgxR7310Btlr/Mmmh
Stock Number:
045409-MU
Citation ID:
RRID:MMRRC_045409-MU
Other Names:
R7310 (G1)
Major Collection:

Strain Information

Tle4
Name: transducin-like enhancer of split 4
Synonyms: Bce1, Grg4, ESTM14, ESTM13, 5730411M05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21888
VEGA: 19
Homologene: 38259
Gnb5
Name: guanine nucleotide binding protein (G protein), beta 5
Synonyms: G beta 5, Gbeta5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14697
VEGA: 9
HGNC: HGNC:4401
Homologene: 40714
Slc12a5
Name: solute carrier family 12, member 5
Synonyms: KCC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57138
Homologene: 10665
Plin2
Name: perilipin 2
Synonyms: Adfp, adipophilin, Adrp, ADPH
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11520
HGNC: HGNC:248
Homologene: 872
Etv5
Name: ets variant 5
Synonyms: erm, 1110005E01Rik, 8430401F14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104156
HGNC: HGNC:3494
Homologene: 3276
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: Spar, 4931426N11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Map1b
Name: microtubule-associated protein 1B
Synonyms: Mtap-5, Mtap5, LC1, Mtap1b, MAP5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Hnrnpa1
Name: heterogeneous nuclear ribonucleoprotein A1
Synonyms: Hdp, D15Ertd119e, Hnrpa1, hnrnp-A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15382
VEGA: 15
Homologene: 134628
Fgfr1
Name: fibroblast growth factor receptor 1
Synonyms: Flt-2, Fgfr-1, Eask, FGFR-I, Fr1, Hspy
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14182
HGNC: HGNC:3688
Homologene: 69065
Slc7a7
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 7
Synonyms: my+lat1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20540
Homologene: 88701
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: Centb2, 9530039J15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Cdca2
Name: cell division cycle associated 2
Synonyms: 2610311M19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 108912
Homologene: 18444
Tnks2
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2
Synonyms: Parp5b, 5430432P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74493
Homologene: 11890
Gpbp1
Name: GC-rich promoter binding protein 1
Synonyms: 1700034P14Rik, D230035M11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73274
Homologene: 11292
Exog
Name: exo/endonuclease G
Synonyms: ENDOGL2, ENGL-a, ENGL-B, Endogl1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208194
VEGA: 9
HGNC: HGNC:3347
Homologene: 3745
Asap1
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1
Synonyms: Ddef1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13196
HGNC: HGNC:2720
Homologene: 7684
Senp7
Name: SUMO1/sentrin specific peptidase 7
Synonyms: 2410152H17Rik, 2900036C23Rik, 2810413I22Rik, 6030449K19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66315
Homologene: 10778
Sipa1l3
Name: signal-induced proliferation-associated 1 like 3
Synonyms: 2610511M17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74206
Homologene: 77938
Nup205
Name: nucleoporin 205
Synonyms: 3830404O05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70699
Homologene: 45971
Usp10
Name: ubiquitin specific peptidase 10
Synonyms: 2610014N07Rik, Uchrp
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22224
Homologene: 31294
Abl1
Name: c-abl oncogene 1, non-receptor tyrosine kinase
Synonyms: E430008G22Rik, c-Abl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11350
HGNC: HGNC:76
Homologene: 3783
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: ERa, ERalpha, ER[a], ESR, ER-alpha, Estr, Nr3a1, Estra
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Wdr12
Name: WD repeat domain 12
Synonyms: 4933402C23Rik, Ytm1, Ytm1p
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 57750
Homologene: 10098
Rif1
Name: replication timing regulatory factor 1
Synonyms: 6530403D07Rik, D2Ertd145e, 5730435J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
Cluh
Name: clustered mitochondria homolog
Synonyms: 1300001I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74148
Homologene: 9063
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
2810021J22Rik
Name: RIKEN cDNA 2810021J22 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69944
Homologene: 138400
Klk11
Name: kallikrein related-peptidase 11
Synonyms: 2310015I08Rik, Prss20, TLSP, hippostasin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56538
HGNC: HGNC:6359
Homologene: 27048
Gna14
Name: guanine nucleotide binding protein, alpha 14
Synonyms: G alpha 14
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14675
VEGA: 19
HGNC: HGNC:4382
Homologene: 68386
Trim25
Name: tripartite motif-containing 25
Synonyms: estrogen-responsive finger protein, Zfp147
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217069
Homologene: 48325
Usp33
Name: ubiquitin specific peptidase 33
Synonyms: 9830169D19Rik, Vdu1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170822
Homologene: 8996
Styxl2
Name: serine/threonine/tyrosine interacting like 2
Synonyms: C130085G02Rik, Dusp27
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240892
Homologene: 18949
Trhde
Name: TRH-degrading enzyme
Synonyms: 9330155P21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237553
Homologene: 75007
Tnfsf13b
Name: tumor necrosis factor (ligand) superfamily, member 13b
Synonyms: TALL-1, BLyS, BAFF, zTNF4, D8Ertd387e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24099
Homologene: 48443
Entpd3
Name: ectonucleoside triphosphate diphosphohydrolase 3
Synonyms: Cd39l3, HB6, NTPDase-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215446
HGNC: HGNC:3365
Homologene: 68171
Cep164
Name: centrosomal protein 164
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214552
Homologene: 51110
Nadk2
Name: NAD kinase 2, mitochondrial
Synonyms: Nadkd1, MNADK, 4933430B08Rik, 1110020G09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68646
Homologene: 14638
Spdye4b
Name: speedy/RINGO cell cycle regulator family, member E4B
Synonyms: 4933411G11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330228
Homologene: 138445
Mttp
Name: microsomal triglyceride transfer protein
Synonyms: 1810043K16Rik, MTP
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17777
HGNC: HGNC:7467
Homologene: 212
Nlgn2
Name: neuroligin 2
Synonyms: NL2, NLG2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216856
Homologene: 69317
Zkscan2
Name: zinc finger with KRAB and SCAN domains 2
Synonyms: Zfp694, 9430065N20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210162
Homologene: 19671
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
Kng2
Name: kininogen 2
Synonyms: Kininogen-II
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385643
HGNC: HGNC:6383
Homologene: 88343
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: LOC235639, C030048J01Rik, Lba1, A230061D21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Arhgap5
Name: Rho GTPase activating protein 5
Synonyms: p190-B, p190B
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11855
VEGA: 12
HGNC: HGNC:675
Homologene: 907
Exoc3l
Name: exocyst complex component 3-like
Synonyms: C730015A04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277978
Homologene: 18629
Or51ab3
Name: olfactory receptor family 51 subfamily AB member 3
Synonyms: GA_x6K02T2PBJ9-6275524-6276477, GA_x6K02T2PBJ9-6271959-6272393, Olfr614, MOR20-1, Olfr613, MOR20-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259104
Homologene: 17505
Igsf3
Name: immunoglobulin superfamily, member 3
Synonyms: 2810035F16Rik, 1700016K10Rik, 4833439O17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78908
HGNC: HGNC:5950
Homologene: 1182
Nol4
Name: nucleolar protein 4
Synonyms: 4930568N03Rik, LOC383304, 1700013J13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319211
HGNC: HGNC:7870
Homologene: 36142
Myo1a
Name: myosin IA
Synonyms: brush border myosin 1, Myhl, BBM-I
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
Atrnl1
Name: attractin like 1
Synonyms: Alp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226255
VEGA: 19
Homologene: 45809
Abcg3
Name: ATP binding cassette subfamily G member 3
Synonyms: Abcp2, Mxr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27405
HGNC: HGNC:74
Homologene: 86845
Proc
Name: protein C
Synonyms: PC, inactivator of coagulation factors Va, VIII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19123
VEGA: 18
HGNC: HGNC:9451
Homologene: 37288
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Mpeg1
Name: macrophage expressed gene 1
Synonyms: MPS1, Mpg-1, Perforin-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17476
VEGA: 19
Homologene: 11216
Kdr
Name: kinase insert domain protein receptor
Synonyms: Flk1, VEGFR2, Flk-1, VEGFR-2, vascular endothelial growth factor receptor- 2, orv, VEGF receptor-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
Bmi1
Name: Bmi1 polycomb ring finger oncogene
Synonyms: Bmi1, Pcgf4, Bmi-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12151
Homologene: 3797
Ncf1
Name: neutrophil cytosolic factor 1
Synonyms: NOXO2, p47phox, Ncf-1, p47phox, NADPH oxidase subunit (47kDa)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17969
Homologene: 30964
Mmp13
Name: matrix metallopeptidase 13
Synonyms: Collagenase-3, interstitial collagenase, collagenase-1, MMP-13, Clg, Mmp1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17386
VEGA: 9
HGNC: HGNC:7159
Homologene: 20548
Rmc1
Name: regulator of MON1-CCZ1
Synonyms: 3110002H16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 76482
Homologene: 8341
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Ndufb10
Name: NADH:ubiquinone oxidoreductase subunit B10
Synonyms: 0610011B04Rik, 22kDa
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68342
HGNC: HGNC:7696
Homologene: 3343
Cacna2d1
Name: calcium channel, voltage-dependent, alpha2/delta subunit 1
Synonyms: Cchl2a, Ca(v)alpha2delta1, Cacna2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12293
HGNC: HGNC:1399
Homologene: 579
Card14
Name: caspase recruitment domain family, member 14
Synonyms: CARMA2, Bimp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170720
Homologene: 11469
Or1e32
Name: olfactory receptor family 1 subfamily E member 32
Synonyms: Olfr392, MOR135-9, GA_x6K02T2P1NL-3966976-3966038
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259008
Homologene: 133580
Daxx
Name: Fas death domain-associated protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13163
HGNC: HGNC:2681
Homologene: 1033
Or5b97
Name: olfactory receptor family 5 subfamily B member 97
Synonyms: GA_x6K02T2RE5P-3231251-3230331, MOR202-3, Olfr1447
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258698
HGNC: HGNC:8324
Homologene: 74233
C130050O18Rik
Name: RIKEN cDNA C130050O18 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319772
Homologene: 138442
Zswim5
Name: zinc finger SWIM-type containing 5
Synonyms: 4933426E21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74464
Homologene: 18958
Ugt2b36
Name: UDP glucuronosyltransferase 2 family, polypeptide B36
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231396
Homologene: 128251
Rundc3b
Name: RUN domain containing 3B
Synonyms: LOC242819
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242819
Homologene: 16286
Bpifc
Name: BPI fold containing family C
Synonyms: Bpil2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270757
Homologene: 18383
Cdh22
Name: cadherin 22
Synonyms: PB-cadherin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104010
Homologene: 23148
Hspa8
Name: heat shock protein 8
Synonyms: Hsc70, Hsc73, 2410008N15Rik, Hsc71, Hsp73
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15481
HGNC: HGNC:5241
Homologene: 68524
Akr1c6
Name: aldo-keto reductase family 1, member C6
Synonyms: Akr1c1, 3alpha-HSD, estradiol 17-beta-dehydrogenase (A-specific), Hsd17b5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 83702
Homologene: 84695
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Trim31
Name: tripartite motif-containing 31
Synonyms: HCG1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224762
Homologene: 17137
Mup17
Name: major urinary protein 17
Synonyms: Gm12557
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039206
Homologene: 74304
Msantd5l
Name: Myb/SANT DNA binding domain containing 5 like
Synonyms: BC049762
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193286
Homologene: 77615
Rnf208
Name: ring finger protein 208
Synonyms: 1110061N23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68846
Homologene: 32752
Abat
Name: 4-aminobutyrate aminotransferase
Synonyms: 9630038C02Rik, GABA-T
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268860
HGNC: HGNC:23
Homologene: 542
Xndc1
Name: Xrcc1 N-terminal domain containing 1
Synonyms: Xndr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 102443350
Homologene: 128476
Cdhr17
Name: cadherin related family member 17
Synonyms: Gm28710
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 102640594
Homologene: 141132
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 46,596,967 bp
  • A to T, chromosome 1 at 60,082,575 bp
  • G to A, chromosome 1 at 166,098,731 bp
  • T to C, chromosome 2 at 18,684,419 bp
  • C to A, chromosome 2 at 25,243,575 bp
  • T to C, chromosome 2 at 31,800,592 bp
  • T to C, chromosome 2 at 52,105,619 bp
  • G to A, chromosome 2 at 164,992,440 bp
  • G to T, chromosome 2 at 165,112,294 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC to ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC, chromosome 3 at 95,888,139 bp
  • G to GGGGTCACTGGTTCTT, chromosome 3 at 95,888,148 bp
  • GTTCTGTGGTCACTG to GTTCTGTGGTCACTGATTCTGTGGTCACTG, chromosome 3 at 95,888,173 bp
  • C to A, chromosome 3 at 96,648,159 bp
  • T to A, chromosome 3 at 101,431,579 bp
  • T to C, chromosome 3 at 138,095,022 bp
  • T to G, chromosome 3 at 152,360,389 bp
  • T to A, chromosome 4 at 61,593,692 bp
  • T to A, chromosome 4 at 86,668,391 bp
  • A to T, chromosome 4 at 116,984,688 bp
  • A to T, chromosome 5 at 8,521,011 bp
  • A to T, chromosome 5 at 16,314,916 bp
  • A to G, chromosome 5 at 16,870,248 bp
  • T to A, chromosome 5 at 75,944,325 bp
  • A to T, chromosome 5 at 87,066,279 bp
  • A to C, chromosome 5 at 104,966,766 bp
  • A to T, chromosome 5 at 134,221,761 bp
  • A to T, chromosome 5 at 139,415,238 bp
  • A to C, chromosome 5 at 143,202,348 bp
  • T to A, chromosome 6 at 35,225,969 bp
  • G to T, chromosome 7 at 29,399,696 bp
  • A to T, chromosome 7 at 43,778,830 bp
  • T to A, chromosome 7 at 45,335,803 bp
  • A to C, chromosome 7 at 102,078,731 bp
  • T to A, chromosome 7 at 103,552,685 bp
  • T to C, chromosome 7 at 123,490,053 bp
  • C to A, chromosome 8 at 10,031,651 bp
  • T to A, chromosome 8 at 25,562,315 bp
  • A to T, chromosome 8 at 105,293,708 bp
  • A to G, chromosome 8 at 117,024,034 bp
  • A to C, chromosome 8 at 119,941,605 bp
  • T to C, chromosome 9 at 7,280,880 bp
  • T to G, chromosome 9 at 40,803,408 bp
  • T to C, chromosome 9 at 45,775,366 bp
  • T to A, chromosome 9 at 59,871,153 bp
  • T to C, chromosome 9 at 75,314,288 bp
  • T to C, chromosome 9 at 111,367,126 bp
  • T to C, chromosome 9 at 119,445,003 bp
  • T to A, chromosome 9 at 120,560,755 bp
  • G to A, chromosome 10 at 4,939,259 bp
  • T to A, chromosome 10 at 85,963,027 bp
  • T to C, chromosome 10 at 114,800,573 bp
  • G to T, chromosome 10 at 127,705,828 bp
  • A to C, chromosome 11 at 51,254,647 bp
  • A to T, chromosome 11 at 58,880,268 bp
  • G to A, chromosome 11 at 69,830,583 bp
  • A to C, chromosome 11 at 73,814,286 bp
  • A to G, chromosome 11 at 74,669,459 bp
  • A to T, chromosome 11 at 89,015,782 bp
  • A to C, chromosome 11 at 119,326,179 bp
  • A to T, chromosome 12 at 52,542,487 bp
  • T to C, chromosome 12 at 82,372,495 bp
  • A to T, chromosome 13 at 4,436,355 bp
  • G to A, chromosome 13 at 99,433,655 bp
  • A to G, chromosome 13 at 111,453,390 bp
  • A to G, chromosome 14 at 54,379,025 bp
  • A to T, chromosome 14 at 67,713,224 bp
  • T to C, chromosome 15 at 9,103,381 bp
  • A to G, chromosome 15 at 64,099,530 bp
  • T to A, chromosome 15 at 103,241,457 bp
  • G to A, chromosome 16 at 8,605,593 bp
  • G to A, chromosome 16 at 22,401,737 bp
  • G to A, chromosome 16 at 22,987,772 bp
  • A to T, chromosome 16 at 31,108,154 bp
  • T to C, chromosome 16 at 56,186,082 bp
  • T to C, chromosome 17 at 24,722,214 bp
  • C to A, chromosome 17 at 33,910,461 bp
  • T to A, chromosome 17 at 36,907,302 bp
  • A to G, chromosome 18 at 12,184,915 bp
  • A to T, chromosome 18 at 22,770,744 bp
  • A to T, chromosome 18 at 32,135,899 bp
  • A to T, chromosome 19 at 12,462,251 bp
  • A to G, chromosome 19 at 12,901,273 bp
  • A to T, chromosome 19 at 14,517,791 bp
  • A to T, chromosome 19 at 16,533,749 bp
  • G to A, chromosome 19 at 36,879,439 bp
  • A to T, chromosome 19 at 57,642,424 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7310 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045409-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.