Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7310Btlr/Mmmh
Stock Number:
045409-MU
Citation ID:
RRID:MMRRC_045409-MU
Other Names:
R7310 (G1)
Major Collection:

Strain Information

Tle4
Name: transducin-like enhancer of split 4
Synonyms: Grg4, ESTM13, ESTM14, Bce1, 5730411M05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21888
VEGA: 19
Homologene: 38259
Gnb5
Name: guanine nucleotide binding protein (G protein), beta 5
Synonyms: G beta 5, Gbeta5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14697
VEGA: 9
HGNC: HGNC:4401
Homologene: 40714
Slc12a5
Name: solute carrier family 12, member 5
Synonyms: KCC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57138
Homologene: 10665
Plin2
Name: perilipin 2
Synonyms: Adrp, adipophilin, ADPH, Adfp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11520
HGNC: HGNC:248
Homologene: 872
Etv5
Name: ets variant 5
Synonyms: 8430401F14Rik, erm, 1110005E01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104156
HGNC: HGNC:3494
Homologene: 3276
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 46,596,967 bp
  • A to T, chromosome 1 at 60,082,575 bp
  • G to A, chromosome 1 at 166,098,731 bp
  • T to C, chromosome 2 at 18,684,419 bp
  • C to A, chromosome 2 at 25,243,575 bp
  • T to C, chromosome 2 at 31,800,592 bp
  • T to C, chromosome 2 at 52,105,619 bp
  • G to A, chromosome 2 at 164,992,440 bp
  • G to T, chromosome 2 at 165,112,294 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • ACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC to ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTC, chromosome 3 at 95,888,139 bp
  • G to GGGGTCACTGGTTCTT, chromosome 3 at 95,888,148 bp
  • GTTCTGTGGTCACTG to GTTCTGTGGTCACTGATTCTGTGGTCACTG, chromosome 3 at 95,888,173 bp
  • C to A, chromosome 3 at 96,648,159 bp
  • T to A, chromosome 3 at 101,431,579 bp
  • T to C, chromosome 3 at 138,095,022 bp
  • T to G, chromosome 3 at 152,360,389 bp
  • T to A, chromosome 4 at 61,593,692 bp
  • T to A, chromosome 4 at 86,668,391 bp
  • A to T, chromosome 4 at 116,984,688 bp
  • A to T, chromosome 5 at 8,521,011 bp
  • A to T, chromosome 5 at 16,314,916 bp
  • A to G, chromosome 5 at 16,870,248 bp
  • T to A, chromosome 5 at 75,944,325 bp
  • A to T, chromosome 5 at 87,066,279 bp
  • A to C, chromosome 5 at 104,966,766 bp
  • A to T, chromosome 5 at 134,221,761 bp
  • A to T, chromosome 5 at 139,415,238 bp
  • A to C, chromosome 5 at 143,202,348 bp
  • T to A, chromosome 6 at 35,225,969 bp
  • G to T, chromosome 7 at 29,399,696 bp
  • A to T, chromosome 7 at 43,778,830 bp
  • T to A, chromosome 7 at 45,335,803 bp
  • A to C, chromosome 7 at 102,078,731 bp
  • T to A, chromosome 7 at 103,552,685 bp
  • T to C, chromosome 7 at 123,490,053 bp
  • C to A, chromosome 8 at 10,031,651 bp
  • T to A, chromosome 8 at 25,562,315 bp
  • A to T, chromosome 8 at 105,293,708 bp
  • A to G, chromosome 8 at 117,024,034 bp
  • A to C, chromosome 8 at 119,941,605 bp
  • T to C, chromosome 9 at 7,280,880 bp
  • T to G, chromosome 9 at 40,803,408 bp
  • T to C, chromosome 9 at 45,775,366 bp
  • T to A, chromosome 9 at 59,871,153 bp
  • T to C, chromosome 9 at 75,314,288 bp
  • T to C, chromosome 9 at 111,367,126 bp
  • T to C, chromosome 9 at 119,445,003 bp
  • T to A, chromosome 9 at 120,560,755 bp
  • G to A, chromosome 10 at 4,939,259 bp
  • T to A, chromosome 10 at 85,963,027 bp
  • T to C, chromosome 10 at 114,800,573 bp
  • G to T, chromosome 10 at 127,705,828 bp
  • A to C, chromosome 11 at 51,254,647 bp
  • A to T, chromosome 11 at 58,880,268 bp
  • G to A, chromosome 11 at 69,830,583 bp
  • A to C, chromosome 11 at 73,814,286 bp
  • A to G, chromosome 11 at 74,669,459 bp
  • A to T, chromosome 11 at 89,015,782 bp
  • A to C, chromosome 11 at 119,326,179 bp
  • A to T, chromosome 12 at 52,542,487 bp
  • T to C, chromosome 12 at 82,372,495 bp
  • A to T, chromosome 13 at 4,436,355 bp
  • G to A, chromosome 13 at 99,433,655 bp
  • A to G, chromosome 13 at 111,453,390 bp
  • A to G, chromosome 14 at 54,379,025 bp
  • A to T, chromosome 14 at 67,713,224 bp
  • T to C, chromosome 15 at 9,103,381 bp
  • A to G, chromosome 15 at 64,099,530 bp
  • T to A, chromosome 15 at 103,241,457 bp
  • G to A, chromosome 16 at 8,605,593 bp
  • G to A, chromosome 16 at 22,401,737 bp
  • G to A, chromosome 16 at 22,987,772 bp
  • A to T, chromosome 16 at 31,108,154 bp
  • T to C, chromosome 16 at 56,186,082 bp
  • T to C, chromosome 17 at 24,722,214 bp
  • C to A, chromosome 17 at 33,910,461 bp
  • T to A, chromosome 17 at 36,907,302 bp
  • A to G, chromosome 18 at 12,184,915 bp
  • A to T, chromosome 18 at 22,770,744 bp
  • A to T, chromosome 18 at 32,135,899 bp
  • A to T, chromosome 19 at 12,462,251 bp
  • A to G, chromosome 19 at 12,901,273 bp
  • A to T, chromosome 19 at 14,517,791 bp
  • A to T, chromosome 19 at 16,533,749 bp
  • G to A, chromosome 19 at 36,879,439 bp
  • A to T, chromosome 19 at 57,642,424 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7310 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045409-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.