Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7318Btlr/Mmmh
Stock Number:
045414-MU
Citation ID:
RRID:MMRRC_045414-MU
Other Names:
R7318 (G1)
Major Collection:

Strain Information

Elp2
Name: elongator acetyltransferase complex subunit 2
Synonyms: Stat3-interacting protein, StIP1, Statip1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 58523
VEGA: 18
Homologene: 6019
Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: [b]2-nAchR, Acrb-2, Acrb2, C030030P04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14411
Homologene: 128225
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Cd40
Name: CD40 antigen
Synonyms: Cd40, Bp50, p50, Tnfrsf5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21939
Homologene: 954
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 37,949,855 bp
  • T to A, chromosome 1 at 46,195,372 bp
  • G to T, chromosome 1 at 171,380,463 bp
  • A to T, chromosome 2 at 22,558,320 bp
  • T to C, chromosome 2 at 92,366,028 bp
  • T to C, chromosome 2 at 154,500,454 bp
  • A to T, chromosome 2 at 165,062,335 bp
  • T to C, chromosome 3 at 27,372,467 bp
  • A to G, chromosome 3 at 41,802,551 bp
  • A to T, chromosome 3 at 88,632,303 bp
  • T to A, chromosome 3 at 89,763,367 bp
  • T to G, chromosome 3 at 99,939,983 bp
  • T to C, chromosome 3 at 123,117,319 bp
  • TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG, chromosome 4 at 42,871,823 bp
  • G to T, chromosome 4 at 43,513,089 bp
  • A to G, chromosome 4 at 116,110,709 bp
  • TCCCC to TCCC, chromosome 4 at 142,037,685 bp
  • G to A, chromosome 5 at 36,483,987 bp
  • A to T, chromosome 5 at 65,988,428 bp
  • A to T, chromosome 5 at 110,237,766 bp
  • A to T, chromosome 5 at 150,436,993 bp
  • G to A, chromosome 5 at 151,062,573 bp
  • A to G, chromosome 6 at 40,409,164 bp
  • T to C, chromosome 6 at 96,115,756 bp
  • G to A, chromosome 6 at 121,352,013 bp
  • T to C, chromosome 6 at 121,352,019 bp
  • T to C, chromosome 6 at 121,870,652 bp
  • T to A, chromosome 6 at 138,421,365 bp
  • T to A, chromosome 7 at 4,510,548 bp
  • T to C, chromosome 7 at 27,489,485 bp
  • T to C, chromosome 7 at 40,993,687 bp
  • T to G, chromosome 7 at 66,110,229 bp
  • T to A, chromosome 7 at 102,710,019 bp
  • T to A, chromosome 7 at 103,552,091 bp
  • T to C, chromosome 7 at 104,841,133 bp
  • T to A, chromosome 8 at 82,071,745 bp
  • G to T, chromosome 8 at 85,359,097 bp
  • T to C, chromosome 8 at 123,530,968 bp
  • A to T, chromosome 9 at 14,308,577 bp
  • G to A, chromosome 9 at 21,505,567 bp
  • A to G, chromosome 9 at 51,840,502 bp
  • A to G, chromosome 9 at 104,081,267 bp
  • A to G, chromosome 9 at 122,987,949 bp
  • A to T, chromosome 10 at 18,630,463 bp
  • T to A, chromosome 10 at 58,483,087 bp
  • T to A, chromosome 10 at 88,813,949 bp
  • C to T, chromosome 11 at 29,540,115 bp
  • T to A, chromosome 11 at 62,714,278 bp
  • T to C, chromosome 11 at 69,825,969 bp
  • C to A, chromosome 11 at 80,456,302 bp
  • T to C, chromosome 12 at 84,325,690 bp
  • T to A, chromosome 12 at 114,724,190 bp
  • A to G, chromosome 13 at 13,757,443 bp
  • A to T, chromosome 13 at 100,813,969 bp
  • T to C, chromosome 14 at 26,963,660 bp
  • A to G, chromosome 14 at 55,514,294 bp
  • T to A, chromosome 15 at 76,597,275 bp
  • G to A, chromosome 16 at 20,392,543 bp
  • A to G, chromosome 16 at 31,127,337 bp
  • A to T, chromosome 16 at 32,755,336 bp
  • G to T, chromosome 16 at 97,452,086 bp
  • C to A, chromosome 17 at 29,319,234 bp
  • T to C, chromosome 17 at 33,941,885 bp
  • T to A, chromosome 17 at 40,307,777 bp
  • T to C, chromosome 17 at 69,266,140 bp
  • G to A, chromosome 18 at 24,606,899 bp
  • T to A, chromosome 19 at 4,041,065 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7318 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045414-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.