Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7318Btlr/Mmmh
Stock Number:
045414-MU
Citation ID:
RRID:MMRRC_045414-MU
Other Names:
R7318 (G1)
Major Collection:

Strain Information

Elp2
Name: elongator acetyltransferase complex subunit 2
Synonyms: Stat3-interacting protein, StIP1, Statip1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 58523
VEGA: 18
Homologene: 6019
Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: [b]2-nAchR, Acrb-2, Acrb2, C030030P04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14411
Homologene: 128225
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Cd40
Name: CD40 antigen
Synonyms: Cd40, Bp50, p50, Tnfrsf5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21939
Homologene: 954
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Rad54l
Name: RAD54 like (S. cerevisiae)
Synonyms: RAD54
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19366
HGNC: HGNC:9826
Homologene: 48227
Acap2
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 2
Synonyms: 9530039J15Rik, Centb2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78618
VEGA: 16
Homologene: 8182
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Ankle2
Name: ankyrin repeat and LEM domain containing 2
Synonyms: 1110001J12Rik, D5Ertd585e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71782
Homologene: 35424
Kif15
Name: kinesin family member 15
Synonyms: N-10 kinesin, HKLP2, 3930402I10Rik, 3110023M17Rik, Knsl7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209737
VEGA: 9
Homologene: 23210
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
HGNC: HGNC:9848
Homologene: 87808
Epb41l3
Name: erythrocyte membrane protein band 4.1 like 3
Synonyms: NBL3, 4.1B, DAL1P, Epb4.1l3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13823
HGNC: HGNC:3380
Homologene: 49308
Gas8
Name: growth arrest specific 8
Synonyms: Gas11
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104346
HGNC: HGNC:4166
Homologene: 1135
Abcc5
Name: ATP-binding cassette, sub-family C member 5
Synonyms: Mrp5, Abcc5b, Abcc5a, 2900011L11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27416
HGNC: HGNC:56
Homologene: 21164
Slc30a5
Name: solute carrier family 30 (zinc transporter), member 5
Synonyms: Zntl1, ZnT-5, ZTL1, 1810010K08Rik, Znt5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69048
VEGA: 13
Homologene: 41503
Ghsr
Name: growth hormone secretagogue receptor
Synonyms: C530020I22Rik, Ghsr1a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 208188
HGNC: HGNC:4267
Homologene: 57161
Cpne6
Name: copine VI
Synonyms: neuronal copine
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12891
HGNC: HGNC:2319
Homologene: 81815
Car9
Name: carbonic anhydrase 9
Synonyms: CAIX, MN/CA9
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230099
HGNC: HGNC:1383
Homologene: 20325
Chsy1
Name: chondroitin sulfate synthase 1
Synonyms: skt
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269941
Homologene: 8950
Arhgef2
Name: Rho/Rac guanine nucleotide exchange factor 2
Synonyms: Lfc, GEF-H1, LFP40, GEFH1, P40, Lbcl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16800
HGNC: HGNC:682
Homologene: 3468
Zfp410
Name: zinc finger protein 410
Synonyms: D12Ertd748e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52708
VEGA: 12
Homologene: 10918
Psmd11
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Synonyms: P44.5, S9, 1810019E17Rik, C78232, 2810055C24Rik, 2610024G20Rik, 1700089D09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69077
HGNC: HGNC:9556
Homologene: 2108
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 7330406P05Rik, 2900057D21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72993
Homologene: 32143
Tmem51
Name: transmembrane protein 51
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214359
Homologene: 9966
Pi16
Name: peptidase inhibitor 16
Synonyms: 1200009H11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74116
Homologene: 134317
Tnnt1
Name: troponin T1, skeletal, slow
Synonyms: Tnt, skeletal muscle slow-twitch TnT, sTnT, ssTnT
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21955
Homologene: 20704
Zfp287
Name: zinc finger protein 287
Synonyms: SKAT-2, B230333C16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170740
Homologene: 23244
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Nlgn2
Name: neuroligin 2
Synonyms: NL2, NLG2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216856
Homologene: 69317
Large2
Name: LARGE xylosyl- and glucuronyltransferase 2
Synonyms: 5730485C17Rik, Gyltl1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228366
Homologene: 27362
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: 6530403F17Rik, A530023E23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244867
Homologene: 18938
Mx1
Name: MX dynamin-like GTPase 1
Synonyms: myxovirus (influenza) resistance 1 polypeptide, Mx-1, Mx
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17857
Mylk3
Name: myosin light chain kinase 3
Synonyms: D830007F02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213435
Homologene: 35278
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Myo3a
Name: myosin IIIA
Synonyms: 9030416P08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 667663
HGNC: HGNC:7601
Homologene: 49486
Or51ab3
Name: olfactory receptor family 51 subfamily AB member 3
Synonyms: GA_x6K02T2PBJ9-6275524-6276477, GA_x6K02T2PBJ9-6271959-6272393, MOR20-1, MOR20-1, Olfr614, Olfr613
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259104
Homologene: 17505
Inpp4b
Name: inositol polyphosphate-4-phosphatase, type II
Synonyms: E130107I17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234515
HGNC: HGNC:6075
Homologene: 20832
Synpo2
Name: synaptopodin 2
Synonyms: myopodin, Myo, 1110069I04Rik, 9530006G20Rik, 2310068J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 118449
Homologene: 15400
Acad11
Name: acyl-Coenzyme A dehydrogenase family, member 11
Synonyms: 5730439E10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102632
Homologene: 49896
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Mug1
Name: murinoglobulin 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17836
HGNC: HGNC:9750
Homologene: 136663
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Wdr46
Name: WD repeat domain 46
Synonyms: 2310007I04Rik, Bing4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57315
Homologene: 3981
Gstp2
Name: glutathione S-transferase, pi 2
Synonyms: Gst-3, Gst3, Gst p-2, GSTpiA
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14869
HGNC: HGNC:4638
Homologene: 660
Or51e1
Name: olfactory receptor family 51 subfamily E member 1
Synonyms: GA_x6K02T2PBJ9-5425951-5426904, MOR18-1, Olfr558
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259097
Homologene: 17503
D3Ertd751e
Name: DNA segment, Chr 3, ERATO Doi 751, expressed
Synonyms: 4930415G15Rik, 2810009O15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73852
Homologene: 12520
Lmo3
Name: LIM domain only 3
Synonyms: Rbtn-3, Rbtn3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109593
HGNC: HGNC:6643
Homologene: 38552
Lyg1
Name: lysozyme G-like 1
Synonyms: 2300002O18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69541
Homologene: 18376
Mtif2
Name: mitochondrial translational initiation factor 2
Synonyms: IF-2mt, 2410112O06Rik, 2310038D14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76784
HGNC: HGNC:7441
Homologene: 1840
Spata31f3
Name: spermatogenesis associated 31 subfamily F member 3
Synonyms: BC049635, Fam205c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277773
Homologene: 77625
Stard13
Name: StAR related lipid transfer domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
4930433I11Rik
Name: RIKEN cDNA 4930433I11 gene
Synonyms: LOC243944
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243944
Homologene: 77912
Sesn3
Name: sestrin 3
Synonyms: SEST3, 5630400E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75747
Homologene: 14386
Crisp1
Name: cysteine-rich secretory protein 1
Synonyms: CRISP-1, Aeg1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11571
Homologene: 135665
Tada2b
Name: transcriptional adaptor 2B
Synonyms: LOC231151
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231151
Homologene: 51007
Dennd11
Name: DENN domain containing 11
Synonyms: E330009J07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243780
Homologene: 82355
Tafa1
Name: TAFA chemokine like family member 1
Synonyms: Tafa-1, C630007B19Rik, Fam19a1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320265
Homologene: 45655
Nectin4
Name: nectin cell adhesion molecule 4
Synonyms: nectin 4, Prr4, 1200017F15Rik, Pvrl4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71740
Homologene: 32744
Sertad1
Name: SERTA domain containing 1
Synonyms: 1110032C13Rik, Trip-Br1, p34SEI-1, Sei-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 55942
Homologene: 8365
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 37,949,855 bp
  • T to A, chromosome 1 at 46,195,372 bp
  • G to T, chromosome 1 at 171,380,463 bp
  • A to T, chromosome 2 at 22,558,320 bp
  • T to C, chromosome 2 at 92,366,028 bp
  • T to C, chromosome 2 at 154,500,454 bp
  • A to T, chromosome 2 at 165,062,335 bp
  • T to C, chromosome 3 at 27,372,467 bp
  • A to G, chromosome 3 at 41,802,551 bp
  • A to T, chromosome 3 at 88,632,303 bp
  • T to A, chromosome 3 at 89,763,367 bp
  • T to G, chromosome 3 at 99,939,983 bp
  • T to C, chromosome 3 at 123,117,319 bp
  • TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG, chromosome 4 at 42,871,823 bp
  • G to T, chromosome 4 at 43,513,089 bp
  • A to G, chromosome 4 at 116,110,709 bp
  • TCCCC to TCCC, chromosome 4 at 142,037,685 bp
  • G to A, chromosome 5 at 36,483,987 bp
  • A to T, chromosome 5 at 65,988,428 bp
  • A to T, chromosome 5 at 110,237,766 bp
  • A to T, chromosome 5 at 150,436,993 bp
  • G to A, chromosome 5 at 151,062,573 bp
  • A to G, chromosome 6 at 40,409,164 bp
  • T to C, chromosome 6 at 96,115,756 bp
  • G to A, chromosome 6 at 121,352,013 bp
  • T to C, chromosome 6 at 121,352,019 bp
  • T to C, chromosome 6 at 121,870,652 bp
  • T to A, chromosome 6 at 138,421,365 bp
  • T to A, chromosome 7 at 4,510,548 bp
  • T to C, chromosome 7 at 27,489,485 bp
  • T to C, chromosome 7 at 40,993,687 bp
  • T to G, chromosome 7 at 66,110,229 bp
  • T to A, chromosome 7 at 102,710,019 bp
  • T to A, chromosome 7 at 103,552,091 bp
  • T to C, chromosome 7 at 104,841,133 bp
  • T to A, chromosome 8 at 82,071,745 bp
  • G to T, chromosome 8 at 85,359,097 bp
  • T to C, chromosome 8 at 123,530,968 bp
  • A to T, chromosome 9 at 14,308,577 bp
  • G to A, chromosome 9 at 21,505,567 bp
  • A to G, chromosome 9 at 51,840,502 bp
  • A to G, chromosome 9 at 104,081,267 bp
  • A to G, chromosome 9 at 122,987,949 bp
  • A to T, chromosome 10 at 18,630,463 bp
  • T to A, chromosome 10 at 58,483,087 bp
  • T to A, chromosome 10 at 88,813,949 bp
  • C to T, chromosome 11 at 29,540,115 bp
  • T to A, chromosome 11 at 62,714,278 bp
  • T to C, chromosome 11 at 69,825,969 bp
  • C to A, chromosome 11 at 80,456,302 bp
  • T to C, chromosome 12 at 84,325,690 bp
  • T to A, chromosome 12 at 114,724,190 bp
  • A to G, chromosome 13 at 13,757,443 bp
  • A to T, chromosome 13 at 100,813,969 bp
  • T to C, chromosome 14 at 26,963,660 bp
  • A to G, chromosome 14 at 55,514,294 bp
  • T to A, chromosome 15 at 76,597,275 bp
  • G to A, chromosome 16 at 20,392,543 bp
  • A to G, chromosome 16 at 31,127,337 bp
  • A to T, chromosome 16 at 32,755,336 bp
  • G to T, chromosome 16 at 97,452,086 bp
  • C to A, chromosome 17 at 29,319,234 bp
  • T to C, chromosome 17 at 33,941,885 bp
  • T to A, chromosome 17 at 40,307,777 bp
  • T to C, chromosome 17 at 69,266,140 bp
  • G to A, chromosome 18 at 24,606,899 bp
  • T to A, chromosome 19 at 4,041,065 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7318 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045414-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.