Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7319Btlr/Mmmh
Stock Number:
045415-MU
Citation ID:
RRID:MMRRC_045415-MU
Other Names:
R7319 (G1)
Major Collection:

Strain Information

Chrna6
Name: cholinergic receptor, nicotinic, alpha polypeptide 6
Synonyms: Acra6, alpha6 nAChR
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11440
Homologene: 20888
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Tnf
Name: tumor necrosis factor
Synonyms: TNF-alpha, tumor necrosis factor-alpha, TNF alpha, TNFalpha, DIF, Tnfsf1a, Tnfa
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21926
Homologene: 496
Nudt2
Name: nudix hydrolase 2
Synonyms: APAH1, 2310051L06Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66401
HGNC: HGNC:8049
Homologene: 896
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Aco2
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e, Irp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11429
HGNC: HGNC:118
Homologene: 856
Topors
Name: topoisomerase I binding, arginine/serine-rich
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106021
Homologene: 4237
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 11,162,308 bp
  • T to A, chromosome 1 at 46,780,775 bp
  • T to C, chromosome 1 at 46,784,448 bp
  • T to A, chromosome 1 at 54,263,337 bp
  • T to A, chromosome 1 at 58,152,602 bp
  • T to G, chromosome 1 at 89,153,102 bp
  • T to C, chromosome 1 at 107,273,087 bp
  • T to C, chromosome 1 at 134,079,041 bp
  • T to C, chromosome 1 at 175,653,655 bp
  • A to G, chromosome 2 at 29,413,478 bp
  • G to A, chromosome 2 at 30,038,329 bp
  • A to G, chromosome 2 at 72,364,718 bp
  • A to T, chromosome 2 at 79,636,072 bp
  • T to A, chromosome 2 at 127,595,842 bp
  • T to A, chromosome 2 at 152,520,054 bp
  • C to T, chromosome 2 at 181,109,102 bp
  • C to T, chromosome 3 at 88,981,387 bp
  • T to A, chromosome 3 at 107,458,784 bp
  • A to G, chromosome 4 at 40,260,540 bp
  • A to T, chromosome 4 at 41,477,575 bp
  • G to A, chromosome 4 at 74,336,963 bp
  • G to A, chromosome 4 at 88,629,947 bp
  • A to T, chromosome 4 at 88,880,006 bp
  • A to T, chromosome 4 at 128,393,679 bp
  • A to G, chromosome 4 at 152,108,428 bp
  • G to A, chromosome 5 at 33,727,802 bp
  • G to A, chromosome 5 at 90,571,766 bp
  • A to G, chromosome 5 at 123,999,111 bp
  • T to A, chromosome 5 at 137,639,715 bp
  • A to G, chromosome 5 at 139,760,765 bp
  • T to A, chromosome 6 at 7,871,150 bp
  • A to G, chromosome 6 at 38,332,274 bp
  • A to C, chromosome 6 at 54,624,221 bp
  • C to A, chromosome 6 at 57,604,089 bp
  • A to G, chromosome 6 at 132,980,700 bp
  • C to T, chromosome 7 at 16,079,369 bp
  • T to C, chromosome 7 at 19,035,845 bp
  • T to C, chromosome 7 at 30,526,369 bp
  • C to T, chromosome 7 at 44,392,529 bp
  • T to A, chromosome 7 at 45,794,316 bp
  • T to A, chromosome 7 at 85,233,834 bp
  • T to C, chromosome 7 at 126,671,649 bp
  • A to G, chromosome 7 at 127,482,813 bp
  • A to T, chromosome 8 at 10,476,185 bp
  • A to G, chromosome 8 at 27,406,787 bp
  • C to T, chromosome 8 at 70,452,942 bp
  • C to T, chromosome 8 at 72,146,477 bp
  • T to A, chromosome 8 at 122,813,031 bp
  • T to C, chromosome 9 at 18,485,121 bp
  • T to A, chromosome 9 at 36,722,643 bp
  • T to G, chromosome 9 at 80,126,199 bp
  • T to A, chromosome 9 at 122,750,363 bp
  • T to C, chromosome 10 at 116,341,404 bp
  • A to T, chromosome 11 at 30,807,790 bp
  • A to G, chromosome 11 at 51,598,703 bp
  • T to C, chromosome 11 at 69,746,370 bp
  • A to G, chromosome 11 at 73,250,794 bp
  • A to T, chromosome 12 at 114,788,543 bp
  • C to T, chromosome 13 at 23,791,401 bp
  • C to G, chromosome 13 at 33,488,560 bp
  • T to C, chromosome 13 at 99,967,733 bp
  • A to T, chromosome 13 at 114,458,532 bp
  • G to A, chromosome 14 at 31,140,826 bp
  • A to G, chromosome 14 at 31,296,594 bp
  • A to G, chromosome 14 at 55,494,360 bp
  • G to A, chromosome 14 at 55,637,975 bp
  • A to T, chromosome 14 at 70,156,186 bp
  • G to A, chromosome 14 at 72,460,489 bp
  • A to G, chromosome 15 at 33,250,039 bp
  • G to T, chromosome 15 at 81,903,619 bp
  • A to G, chromosome 16 at 20,617,916 bp
  • A to G, chromosome 16 at 32,994,993 bp
  • A to G, chromosome 16 at 48,927,540 bp
  • A to T, chromosome 17 at 6,991,767 bp
  • A to G, chromosome 17 at 25,389,461 bp
  • A to G, chromosome 17 at 35,200,371 bp
  • GGGGTGGGCATAGATCCTGAGGCAGAGCTGGATGCAGTGGTGGTCAGGGTGGG to GGGGTGGG, chromosome 17 at 35,622,043 bp
  • A to G, chromosome 17 at 70,844,852 bp
  • T to A, chromosome 18 at 11,732,212 bp
  • C to T, chromosome 18 at 37,013,192 bp
  • G to A, chromosome 18 at 75,063,174 bp
  • G to A, chromosome 18 at 77,185,520 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7319 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045415-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.