Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7330Btlr/Mmmh
Stock Number:
045423-MU
Citation ID:
RRID:MMRRC_045423-MU
Other Names:
R7330 (G1)
Major Collection:

Strain Information

Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Gtf3c1
Name: general transcription factor III C 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233863
HGNC: HGNC:4664
Homologene: 31040
Actr2
Name: actin related protein 2
Synonyms: 4921510D23Rik, D6Ertd746e, Arp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66713
HGNC: HGNC:169
Homologene: 4181
Tipin
Name: timeless interacting protein
Synonyms: 1110018P21Rik, 1110005A05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66131
VEGA: 9
Homologene: 32373
Ubr7
Name: ubiquitin protein ligase E3 component n-recognin 7 (putative)
Synonyms: 5730410I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66622
VEGA: 12
Homologene: 11998
Utp18
Name: UTP18 small subunit processome component
Synonyms: 6230425C22Rik, Wdr50
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217109
Homologene: 41087
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Itpr-1, Ip3r, Pcp-1, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Lonp2
Name: lon peptidase 2, peroxisomal
Synonyms: 1300002A08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66887
Homologene: 12050
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Cep135
Name: centrosomal protein 135
Synonyms: LOC381644, Cep4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381644
Homologene: 45709
Ucn3
Name: urocortin 3
Synonyms: Urocortin III
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 83428
VEGA: 13
Homologene: 49959
Grm4
Name: glutamate receptor, metabotropic 4
Synonyms: mGluR4, Gprc1d
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268934
HGNC: HGNC:4596
Homologene: 20230
Prpf31
Name: pre-mRNA processing factor 31
Synonyms: 2810404O06Rik, PRP31, RP11, 1500019O16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68988
Homologene: 5980
Gapdh
Name: glyceraldehyde-3-phosphate dehydrogenase
Synonyms: Gapd, Gapd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14433
HGNC: HGNC:4141
Homologene: 107053
Il6st
Name: interleukin 6 signal transducer
Synonyms: gp130, CD130, D13Ertd699e, 5133400A03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16195
HGNC: HGNC:6021
Homologene: 1645
Limk2
Name: LIM domain kinase 2
Synonyms: Limk2b, Limk2a, A930024P04Rik, LIM kinase 2, whe
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16886
HGNC: HGNC:6614
Homologene: 55911
Camkk1
Name: calcium/calmodulin-dependent protein kinase kinase 1, alpha
Synonyms: CaMKKalpha
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 55984
HGNC: HGNC:1469
Homologene: 10327
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Ropn1l
Name: ropporin 1-like
Synonyms: AKAP-associated sperm protein, ASP
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 252967
VEGA: 15
Homologene: 12904
Cilp
Name: cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms: C130036G17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214425
HGNC: HGNC:1980
Homologene: 2679
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Atp1a3
Name: ATPase, Na+/K+ transporting, alpha 3 polypeptide
Synonyms: Atpa-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232975
HGNC: HGNC:801
Homologene: 113729
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: NY-CO-33, D18Bwg1409e, 5730407I04Rik, Mtsh1, Sdccag33, teashirt1, Tsh1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110796
Homologene: 4227
Myt1l
Name: myelin transcription factor 1-like
Synonyms: Png-1, Nztf1, Pmng1, C630034G21Rik, 2900093J19Rik, 2900046C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17933
VEGA: 12
HGNC: HGNC:7623
Homologene: 7435
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Acot12
Name: acyl-CoA thioesterase 12
Synonyms: 1300004O04Rik, 4930449F15Rik, Cach
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74156
Homologene: 12540
Stox2
Name: storkhead box 2
Synonyms: 4933409N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71069
Homologene: 18414
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Or1j18
Name: olfactory receptor family 1 subfamily J member 18
Synonyms: GA_x6K02T2NLDC-33428755-33429693, MOR136-9, Olfr347
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258945
Homologene: 51790
Dhh
Name: desert hedgehog
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13363
VEGA: 15
HGNC: HGNC:2865
Homologene: 22431
Edar
Name: ectodysplasin-A receptor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13608
HGNC: HGNC:2895
Homologene: 7699
Wsb2
Name: WD repeat and SOCS box-containing 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59043
Homologene: 32417
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665210
Homologene: 115024
Clcnkb
Name: chloride channel, voltage-sensitive Kb
Synonyms: Clcnk1l, Clck2, ClC-K2, Clcnk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56365
Homologene: 107317
Cpvl
Name: carboxypeptidase, vitellogenic-like
Synonyms: 4933436L16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71287
Homologene: 80235
Or5d35
Name: olfactory receptor family 5 subfamily D member 35
Synonyms: GA_x6K02T2Q125-49516664-49517629, MOR174-2, Olfr1161
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258845
Homologene: 138318
Or6c8b
Name: olfactory receptor family 6 subfamily C member 8B
Synonyms: GA_x6K02T2PULF-10732607-10731678, MOR115-4, Olfr765
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544748
Homologene: 105186
Cdh18
Name: cadherin 18
Synonyms: B230220E17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320865
HGNC: HGNC:1757
Homologene: 55858
Acaa1b
Name: acetyl-Coenzyme A acyltransferase 1B
Synonyms: thiolase B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235674
HGNC: HGNC:82
Homologene: 91131
Ttll3
Name: tubulin tyrosine ligase-like family, member 3
Synonyms: 4833441J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101100
Homologene: 134361
Spef1
Name: sperm flagellar 1
Synonyms: 4931426K16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70997
Homologene: 15741
Ace
Name: angiotensin I converting enzyme
Synonyms: CD143
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11421
HGNC: HGNC:2707
Homologene: 37351
Selenbp1
Name: selenium binding protein 1
Synonyms: Lp56, Lpsb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20341
Homologene: 2930
Ak8
Name: adenylate kinase 8
Synonyms: 1190002A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68870
Homologene: 17622
Or7g25
Name: olfactory receptor family 7 subfamily G member 25
Synonyms: GA_x6K02T2PVTD-12986331-12985390, MOR155-2, Olfr843
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258560
HGNC: HGNC:8466
Homologene: 74251
Vmn1r189
Name: vomeronasal 1 receptor 189
Synonyms: V1rh2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 252906
Homologene: 110880
Ahsa2
Name: AHA1, activator of heat shock protein ATPase 2
Synonyms: 1110064P04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268390
Homologene: 72214
Cyp2c68
Name: cytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms: 9030012A22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433247
HGNC: HGNC:2622
Homologene: 74936
Clrn3
Name: clarin 3
Synonyms: Tmem12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212070
Homologene: 17544
Clstn2
Name: calsyntenin 2
Synonyms: CS2, 2900042C18Rik, Cst-2, CSTN2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64085
Homologene: 49698
Zfp72
Name: zinc finger protein 72
Synonyms: Zfp74
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238722
VEGA: 13
Homologene: 108290
Lat2
Name: linker for activation of T cells family, member 2
Synonyms: Wbscr15, Wbscr5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56743
Homologene: 11297
Bbs2
Name: Bardet-Biedl syndrome 2
Synonyms: 2410125H22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67378
HGNC: HGNC:967
Homologene: 12122
Igkv4-72
Name: immunoglobulin kappa chain variable 4-72
Synonyms: LOC385109, Gm1499
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 385109
Pcdhga12
Name: protocadherin gamma subfamily A, 12
Synonyms: pc2c, Pcdh13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93724
HGNC: HGNC:8699
Homologene: 134588
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 2 at 28,812,935 bp
  • T to A, chromosome 2 at 36,735,045 bp
  • C to T, chromosome 2 at 52,189,703 bp
  • C to T, chromosome 2 at 76,917,011 bp
  • C to A, chromosome 2 at 88,024,921 bp
  • G to A, chromosome 2 at 131,172,733 bp
  • T to A, chromosome 3 at 94,939,710 bp
  • C to A, chromosome 4 at 32,723,685 bp
  • T to A, chromosome 4 at 141,308,453 bp
  • A to G, chromosome 4 at 141,410,612 bp
  • T to A, chromosome 5 at 76,606,745 bp
  • A to G, chromosome 5 at 117,370,762 bp
  • T to A, chromosome 5 at 134,606,787 bp
  • A to G, chromosome 6 at 48,475,462 bp
  • A to G, chromosome 6 at 53,974,759 bp
  • C to T, chromosome 6 at 69,227,103 bp
  • G to A, chromosome 6 at 108,438,331 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • A to AAGTAC, chromosome 6 at 113,399,164 bp
  • A to G, chromosome 6 at 125,162,937 bp
  • A to G, chromosome 7 at 3,639,855 bp
  • T to A, chromosome 7 at 25,001,152 bp
  • T to C, chromosome 7 at 125,703,883 bp
  • G to T, chromosome 7 at 135,528,469 bp
  • A to G, chromosome 8 at 47,192,236 bp
  • C to A, chromosome 8 at 86,631,394 bp
  • T to A, chromosome 8 at 94,087,405 bp
  • T to A, chromosome 9 at 19,249,271 bp
  • A to G, chromosome 9 at 64,288,226 bp
  • A to T, chromosome 9 at 65,280,245 bp
  • G to T, chromosome 9 at 97,461,369 bp
  • A to T, chromosome 9 at 107,791,045 bp
  • A to G, chromosome 9 at 108,045,253 bp
  • T to C, chromosome 9 at 119,148,382 bp
  • T to C, chromosome 10 at 5,128,434 bp
  • T to G, chromosome 10 at 58,610,554 bp
  • GAA to GA, chromosome 10 at 88,787,562 bp
  • C to T, chromosome 10 at 129,046,464 bp
  • T to C, chromosome 11 at 3,346,311 bp
  • A to T, chromosome 11 at 20,072,544 bp
  • G to T, chromosome 11 at 23,490,558 bp
  • C to G, chromosome 11 at 73,027,047 bp
  • A to T, chromosome 11 at 93,882,073 bp
  • A to G, chromosome 11 at 105,986,061 bp
  • T to A, chromosome 12 at 29,851,554 bp
  • A to G, chromosome 12 at 102,775,712 bp
  • A to T, chromosome 13 at 3,941,216 bp
  • A to G, chromosome 13 at 22,102,541 bp
  • T to G, chromosome 13 at 74,375,034 bp
  • T to A, chromosome 13 at 91,741,532 bp
  • T to A, chromosome 13 at 112,493,651 bp
  • G to A, chromosome 15 at 23,226,950 bp
  • T to C, chromosome 15 at 31,451,203 bp
  • G to T, chromosome 15 at 59,333,667 bp
  • G to A, chromosome 15 at 68,212,751 bp
  • A to G, chromosome 15 at 98,894,410 bp
  • TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC to TACCATGGACTCCCAGATGTTAGCCTCTAGCACCATGGACTCCCAGATGTTAGCAACTAGCACCATGGACTCCCAGATGTTAGC, chromosome 16 at 91,656,598 bp
  • T to C, chromosome 17 at 18,106,167 bp
  • C to T, chromosome 17 at 27,434,824 bp
  • T to A, chromosome 17 at 34,730,472 bp
  • T to C, chromosome 18 at 37,768,386 bp
  • T to A, chromosome 18 at 84,014,831 bp
  • A to G, chromosome 19 at 39,689,190 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7330 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045423-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.