Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7358Btlr/Mmmh
Stock Number:
045444-MU
Citation ID:
RRID:MMRRC_045444-MU
Other Names:
R7358 (G1)
Major Collection:

Strain Information

Ptprcap
Name: protein tyrosine phosphatase receptor type C polypeptide-associated protein
Synonyms: LSM-1, CD-45-AP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19265
HGNC: HGNC:9667
Homologene: 48358
Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Prkcd
Name: protein kinase C, delta
Synonyms: PKCdelta, PKC[d], Pkcd, D14Ertd420e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18753
HGNC: HGNC:9399
Homologene: 55963
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Cradd
Name: CASP2 and RIPK1 domain containing adaptor with death domain
Synonyms: RAIDD
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12905
VEGA: 10
HGNC: HGNC:2340
Homologene: 2821
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 14,898,110 bp
  • T to A, chromosome 1 at 34,191,673 bp
  • T to C, chromosome 1 at 55,237,570 bp
  • A to G, chromosome 1 at 69,844,367 bp
  • G to A, chromosome 1 at 72,267,465 bp
  • A to T, chromosome 1 at 135,964,000 bp
  • A to G, chromosome 1 at 181,135,036 bp
  • A to T, chromosome 2 at 26,255,995 bp
  • T to A, chromosome 2 at 31,416,812 bp
  • C to T, chromosome 2 at 34,690,461 bp
  • T to C, chromosome 2 at 36,869,878 bp
  • T to A, chromosome 2 at 65,682,506 bp
  • C to T, chromosome 2 at 76,707,305 bp
  • T to A, chromosome 2 at 85,975,436 bp
  • A to G, chromosome 2 at 119,070,559 bp
  • C to T, chromosome 2 at 120,790,310 bp
  • A to G, chromosome 2 at 127,221,826 bp
  • T to A, chromosome 2 at 152,876,630 bp
  • T to C, chromosome 2 at 155,299,170 bp
  • A to T, chromosome 2 at 180,717,986 bp
  • A to T, chromosome 3 at 41,746,565 bp
  • G to T, chromosome 3 at 93,323,141 bp
  • T to A, chromosome 3 at 145,293,165 bp
  • T to A, chromosome 3 at 157,991,737 bp
  • A to G, chromosome 4 at 126,566,200 bp
  • G to T, chromosome 4 at 133,633,171 bp
  • A to T, chromosome 5 at 122,666,142 bp
  • C to A, chromosome 5 at 134,502,630 bp
  • A to G, chromosome 5 at 136,095,594 bp
  • C to A, chromosome 5 at 138,301,508 bp
  • A to G, chromosome 5 at 150,416,323 bp
  • A to T, chromosome 6 at 31,524,994 bp
  • G to A, chromosome 6 at 43,279,573 bp
  • A to G, chromosome 6 at 125,710,733 bp
  • A to T, chromosome 7 at 4,551,007 bp
  • G to A, chromosome 7 at 4,829,921 bp
  • A to C, chromosome 7 at 42,578,489 bp
  • A to T, chromosome 7 at 42,662,791 bp
  • A to G, chromosome 7 at 56,182,675 bp
  • A to T, chromosome 7 at 85,624,260 bp
  • G to A, chromosome 7 at 99,232,466 bp
  • A to T, chromosome 7 at 102,210,567 bp
  • A to G, chromosome 7 at 103,629,183 bp
  • A to T, chromosome 7 at 106,926,904 bp
  • T to C, chromosome 7 at 110,399,348 bp
  • A to G, chromosome 7 at 132,998,881 bp
  • A to C, chromosome 8 at 90,983,487 bp
  • A to G, chromosome 8 at 91,034,218 bp
  • T to C, chromosome 8 at 94,575,699 bp
  • A to T, chromosome 8 at 127,593,092 bp
  • A to G, chromosome 9 at 7,159,479 bp
  • T to C, chromosome 9 at 14,729,993 bp
  • A to T, chromosome 9 at 20,100,873 bp
  • C to T, chromosome 10 at 23,123,851 bp
  • T to A, chromosome 10 at 50,714,352 bp
  • T to C, chromosome 10 at 61,696,648 bp
  • A to G, chromosome 10 at 82,292,013 bp
  • T to A, chromosome 10 at 95,322,775 bp
  • T to A, chromosome 10 at 129,160,070 bp
  • T to G, chromosome 11 at 8,945,202 bp
  • T to A, chromosome 11 at 23,361,683 bp
  • G to A, chromosome 11 at 61,308,873 bp
  • T to C, chromosome 11 at 69,847,490 bp
  • A to C, chromosome 11 at 76,213,452 bp
  • C to T, chromosome 11 at 80,133,036 bp
  • A to G, chromosome 12 at 16,724,881 bp
  • G to T, chromosome 12 at 78,881,195 bp
  • A to G, chromosome 12 at 87,280,040 bp
  • T to C, chromosome 12 at 105,592,541 bp
  • A to T, chromosome 13 at 30,380,979 bp
  • G to C, chromosome 13 at 32,842,998 bp
  • T to C, chromosome 13 at 90,883,807 bp
  • A to G, chromosome 13 at 113,319,967 bp
  • A to G, chromosome 14 at 12,154,198 bp
  • T to C, chromosome 14 at 30,605,836 bp
  • A to G, chromosome 14 at 31,124,603 bp
  • T to C, chromosome 14 at 31,241,788 bp
  • T to A, chromosome 14 at 56,794,140 bp
  • A to T, chromosome 15 at 79,734,112 bp
  • T to C, chromosome 16 at 46,153,838 bp
  • C to A, chromosome 17 at 17,876,980 bp
  • T to A, chromosome 17 at 23,996,445 bp
  • T to A, chromosome 17 at 24,291,555 bp
  • T to A, chromosome 17 at 87,717,529 bp
  • T to A, chromosome 18 at 36,992,777 bp
  • A to T, chromosome 18 at 77,959,037 bp
  • A to G, chromosome 19 at 4,156,239 bp
  • T to A, chromosome 19 at 6,926,110 bp
  • T to A, chromosome 19 at 58,676,544 bp
  • T to C, chromosome Y at 735,141 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7358 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045444-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.