Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7367Btlr/Mmmh
Stock Number:
045451-MU
Citation ID:
RRID:MMRRC_045451-MU
Other Names:
R7367 (G1)
Major Collection:

Strain Information

Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Ppat
Name: phosphoribosyl pyrophosphate amidotransferase
Synonyms: 5730454C12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231327
HGNC: HGNC:9238
Homologene: 68272
Cisd1
Name: CDGSH iron sulfur domain 1
Synonyms: D10Ertd214e, mitoNEET, Zcd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52637
Homologene: 10212
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Sec23a
Name: SEC23 homolog A, COPII coat complex component
Synonyms: Sec23r, Msec23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20334
Homologene: 4642
Kif11
Name: kinesin family member 11
Synonyms: Eg5, Knsl1, Kifl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16551
VEGA: 19
HGNC: HGNC:6388
Homologene: 3322
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Agps
Name: alkylglycerone phosphate synthase
Synonyms: ADAPS, 9930035G10Rik, bs2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228061
HGNC: HGNC:327
Homologene: 2716
Hsd17b4
Name: hydroxysteroid (17-beta) dehydrogenase 4
Synonyms: 17[b]-HSD, MFE-2, perMFE-2, multifunctional protein 2, D-bifunctional protein, Mfp-2, MFP2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15488
HGNC: HGNC:5213
Homologene: 358
R3hdm1
Name: R3H domain containing 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226412
HGNC: HGNC:9757
Homologene: 9108
Sh3d19
Name: SH3 domain protein D19
Synonyms: Kryn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27059
Homologene: 19064
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Sarnp
Name: SAP domain containing ribonucleoprotein
Synonyms: 1110005A23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66118
VEGA: 10
Homologene: 41628
Ankrd34b
Name: ankyrin repeat domain 34B
Synonyms: 6430502M16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218440
Homologene: 18450
Pwp2
Name: PWP2 periodic tryptophan protein homolog (yeast)
Synonyms: Pwp2, 6530411D08Rik, Pwp2h
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110816
VEGA: 10
HGNC: HGNC:9711
Homologene: 3702
Dnaaf10
Name: dynein axonemal assembly factor 10
Synonyms: Wdr92
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103784
Homologene: 16321
Ppp1r13l
Name: protein phosphatase 1, regulatory subunit 13 like
Synonyms: NFkB interacting protein 1, wa3, IASPP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 333654
Homologene: 84635
Pax7
Name: paired box 7
Synonyms: Pax-7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18509
HGNC: HGNC:8621
Homologene: 55665
Kcnv1
Name: potassium channel, subfamily V, member 1
Synonyms: 2700023A03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67498
VEGA: 15
Homologene: 22811
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1279Clo, b2b1203Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Sugct
Name: succinyl-CoA glutarate-CoA transferase
Synonyms: 5033411D12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 192136
VEGA: 13
Homologene: 11681
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Atp10b
Name: ATPase, class V, type 10B
Synonyms: 5930426O13Rik, 9030605H24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319767
Homologene: 70969
Htra4
Name: HtrA serine peptidase 4
Synonyms: B430206E18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330723
Homologene: 17801
Golgb1
Name: golgin B1
Synonyms: Giantin, C130074L01Rik, F730017E11Rik, 6330407A06Rik, Gm6840
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224139
HGNC: HGNC:4429
Homologene: 68401
Or5m5
Name: olfactory receptor family 5 subfamily M member 5
Synonyms: GA_x6K02T2Q125-47462755-47463693, MOR196-2, Olfr1030
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258581
Homologene: 64892
Tpsg1
Name: tryptase gamma 1
Synonyms: TMT, Prss31
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26945
Homologene: 74994
Lrrc66
Name: leucine rich repeat containing 66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231296
Homologene: 51944
Cyp2s1
Name: cytochrome P450, family 2, subfamily s, polypeptide 1
Synonyms: 1200011C15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74134
Homologene: 75274
Fsd2
Name: fibronectin type III and SPRY domain containing 2
Synonyms: Spryd1, 9830160G03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244091
Homologene: 18252
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319901
Homologene: 12964
Cnga1
Name: cyclic nucleotide gated channel alpha 1
Synonyms: Cncg
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12788
HGNC: HGNC:2148
Homologene: 55432
Cfh
Name: complement component factor h
Synonyms: Sas-1, Mud-1, Sas1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12628
HGNC: HGNC:4883
Homologene: 20086
Hsd17b6
Name: hydroxysteroid (17-beta) dehydrogenase 6
Synonyms: Rdh8, 17betaHSD9, Hsd17b9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27400
VEGA: 10
Homologene: 20811
Cntnap5a
Name: contactin associated protein-like 5A
Synonyms: Caspr5-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 636808
Homologene: 43974
Zfp956
Name: zinc finger protein 956
Synonyms: AI894139
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101197
Homologene: 128449
Cep250
Name: centrosomal protein 250
Synonyms: Inmp, B230210E21Rik, Cep2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16328
HGNC: HGNC:1859
Homologene: 38286
Or2c1
Name: olfactory receptor family 2 subfamily C member 1
Synonyms: OR3, MOR256-17, GA_x54KRFPKG5P-348087-349025, Olfr15
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18312
HGNC: HGNC:8242
Homologene: 7459
Pak1ip1
Name: PAK1 interacting protein 1
Synonyms: 5830431I15Rik, 5930415H02Rik, p21-activated protein kinase-interacting protein 1, PIP1, Gdpd1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68083
Homologene: 39574
Tle2
Name: transducin-like enhancer of split 2
Synonyms: Grg2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21886
Homologene: 20693
Adh1
Name: alcohol dehydrogenase 1 (class I)
Synonyms: ADH-AA, class I alcohol dehydrogenase, Adh-1-t, Adh-1t, Adh-1, Adh1-t, Adh1-e, Adh1tl, Adh-1e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11522
Homologene: 73888
Flacc1
Name: flagellum associated containing coiled-coil domains 1
Synonyms: 4933405P16Rik, 4933425F06Rik, Als2cr12
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108812
Homologene: 51399
B4galnt4
Name: beta-1,4-N-acetyl-galactosaminyl transferase 4
Synonyms: LOC381951
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330671
Homologene: 27982
Pafah1b3
Name: platelet-activating factor acetylhydrolase, isoform 1b, subunit 3
Synonyms: mus[g], Pafahg, PAF-AH alpha1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18476
HGNC: HGNC:8576
Homologene: 1933
Ccn6
Name: cellular communication network factor 6
Synonyms: LOC327743, CCN6, Wisp3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327743
VEGA: 10
Homologene: 77038
Lrrc32
Name: leucine rich repeat containing 32
Synonyms: D7H11S833E, D11S833Eh, Garp, EG434215
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434215
HGNC: HGNC:4161
Homologene: 4027
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Sh3tc2
Name: SH3 domain and tetratricopeptide repeats 2
Synonyms: D430044G18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225608
VEGA: 18
Homologene: 11596
Or4x11
Name: olfactory receptor family 4 subfamily X member 11
Synonyms: GA_x6K02T2Q125-51469027-51469956, MOR228-2, Olfr1265
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258340
Homologene: 133727
Pex11b
Name: peroxisomal biogenesis factor 11 beta
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18632
HGNC: HGNC:8853
Homologene: 2852
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
H2ac4
Name: H2A clustered histone 4
Synonyms: H2a-53, H2A.1, Hist1h2ab
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319172
Homologene: 137350
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 4,347,998 bp
  • A to T, chromosome 1 at 38,074,407 bp
  • A to T, chromosome 1 at 58,666,864 bp
  • C to T, chromosome 1 at 111,861,573 bp
  • A to G, chromosome 1 at 116,442,295 bp
  • A to G, chromosome 1 at 128,153,392 bp
  • A to T, chromosome 1 at 140,086,521 bp
  • T to A, chromosome 2 at 75,868,313 bp
  • T to C, chromosome 2 at 85,984,343 bp
  • A to G, chromosome 2 at 90,037,812 bp
  • A to G, chromosome 2 at 155,969,307 bp
  • T to C, chromosome 2 at 180,192,958 bp
  • A to G, chromosome 3 at 86,104,228 bp
  • G to A, chromosome 3 at 96,636,678 bp
  • A to G, chromosome 3 at 138,290,551 bp
  • A to G, chromosome 3 at 142,810,727 bp
  • C to T, chromosome 4 at 28,871,937 bp
  • C to T, chromosome 4 at 139,452,691 bp
  • G to A, chromosome 4 at 139,779,749 bp
  • G to A, chromosome 5 at 72,605,358 bp
  • T to C, chromosome 5 at 73,608,381 bp
  • T to A, chromosome 5 at 76,856,602 bp
  • T to A, chromosome 5 at 76,919,864 bp
  • C to T, chromosome 6 at 47,963,919 bp
  • C to G, chromosome 7 at 19,370,156 bp
  • A to G, chromosome 7 at 25,296,066 bp
  • A to T, chromosome 7 at 25,805,973 bp
  • T to A, chromosome 7 at 64,268,801 bp
  • A to G, chromosome 7 at 81,535,180 bp
  • G to T, chromosome 7 at 98,498,879 bp
  • A to G, chromosome 7 at 141,064,475 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to T, chromosome 8 at 25,033,697 bp
  • A to G, chromosome 10 at 39,158,265 bp
  • A to G, chromosome 10 at 71,336,360 bp
  • C to T, chromosome 10 at 78,182,480 bp
  • A to G, chromosome 10 at 81,580,318 bp
  • A to T, chromosome 10 at 88,795,443 bp
  • A to T, chromosome 10 at 127,993,623 bp
  • A to G, chromosome 10 at 128,833,378 bp
  • A to G, chromosome 11 at 17,232,712 bp
  • A to G, chromosome 11 at 43,247,501 bp
  • T to C, chromosome 11 at 69,908,582 bp
  • G to A, chromosome 11 at 78,950,090 bp
  • T to C, chromosome 11 at 118,115,196 bp
  • T to C, chromosome 12 at 58,966,999 bp
  • T to A, chromosome 12 at 117,987,442 bp
  • T to A, chromosome 13 at 17,644,814 bp
  • A to G, chromosome 13 at 23,751,350 bp
  • T to G, chromosome 13 at 41,008,895 bp
  • C to A, chromosome 13 at 92,438,287 bp
  • C to T, chromosome 15 at 45,109,242 bp
  • A to G, chromosome 16 at 3,839,302 bp
  • T to A, chromosome 16 at 36,898,546 bp
  • G to T, chromosome 17 at 25,373,210 bp
  • T to A, chromosome 18 at 50,155,185 bp
  • A to G, chromosome 18 at 61,989,506 bp
  • A to T, chromosome 18 at 90,591,100 bp
  • T to A, chromosome 19 at 37,420,341 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7367 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045451-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text