Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7367Btlr/Mmmh
Stock Number:
045451-MU
Citation ID:
RRID:MMRRC_045451-MU
Other Names:
R7367 (G1)
Major Collection:

Strain Information

Nos2
Name: nitric oxide synthase 2, inducible
Synonyms: iNOS, Nos-2, NOS-II, Nos2a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18126
HGNC: HGNC:7873
Homologene: 55473
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Ppat
Name: phosphoribosyl pyrophosphate amidotransferase
Synonyms: 5730454C12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231327
HGNC: HGNC:9238
Homologene: 68272
Cisd1
Name: CDGSH iron sulfur domain 1
Synonyms: D10Ertd214e, mitoNEET, Zcd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52637
Homologene: 10212
Neurl4
Name: neuralized E3 ubiquitin protein ligase 4
Synonyms: 0610025P10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216860
Homologene: 13029
Sec23a
Name: SEC23 homolog A, COPII coat complex component
Synonyms: Sec23r, Msec23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20334
Homologene: 4642
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 4,347,998 bp
  • A to T, chromosome 1 at 38,074,407 bp
  • A to T, chromosome 1 at 58,666,864 bp
  • C to T, chromosome 1 at 111,861,573 bp
  • A to G, chromosome 1 at 116,442,295 bp
  • A to G, chromosome 1 at 128,153,392 bp
  • A to T, chromosome 1 at 140,086,521 bp
  • T to A, chromosome 2 at 75,868,313 bp
  • T to C, chromosome 2 at 85,984,343 bp
  • A to G, chromosome 2 at 90,037,812 bp
  • A to G, chromosome 2 at 155,969,307 bp
  • T to C, chromosome 2 at 180,192,958 bp
  • A to G, chromosome 3 at 86,104,228 bp
  • G to A, chromosome 3 at 96,636,678 bp
  • A to G, chromosome 3 at 138,290,551 bp
  • A to G, chromosome 3 at 142,810,727 bp
  • C to T, chromosome 4 at 28,871,937 bp
  • C to T, chromosome 4 at 139,452,691 bp
  • G to A, chromosome 4 at 139,779,749 bp
  • G to A, chromosome 5 at 72,605,358 bp
  • T to C, chromosome 5 at 73,608,381 bp
  • T to A, chromosome 5 at 76,856,602 bp
  • T to A, chromosome 5 at 76,919,864 bp
  • C to T, chromosome 6 at 47,963,919 bp
  • C to G, chromosome 7 at 19,370,156 bp
  • A to G, chromosome 7 at 25,296,066 bp
  • A to T, chromosome 7 at 25,805,973 bp
  • T to A, chromosome 7 at 64,268,801 bp
  • A to G, chromosome 7 at 81,535,180 bp
  • G to T, chromosome 7 at 98,498,879 bp
  • A to G, chromosome 7 at 141,064,475 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to T, chromosome 8 at 25,033,697 bp
  • A to G, chromosome 10 at 39,158,265 bp
  • A to G, chromosome 10 at 71,336,360 bp
  • C to T, chromosome 10 at 78,182,480 bp
  • A to G, chromosome 10 at 81,580,318 bp
  • A to T, chromosome 10 at 88,795,443 bp
  • A to T, chromosome 10 at 127,993,623 bp
  • A to G, chromosome 10 at 128,833,378 bp
  • A to G, chromosome 11 at 17,232,712 bp
  • A to G, chromosome 11 at 43,247,501 bp
  • T to C, chromosome 11 at 69,908,582 bp
  • G to A, chromosome 11 at 78,950,090 bp
  • T to C, chromosome 11 at 118,115,196 bp
  • T to C, chromosome 12 at 58,966,999 bp
  • T to A, chromosome 12 at 117,987,442 bp
  • T to A, chromosome 13 at 17,644,814 bp
  • A to G, chromosome 13 at 23,751,350 bp
  • T to G, chromosome 13 at 41,008,895 bp
  • C to A, chromosome 13 at 92,438,287 bp
  • C to T, chromosome 15 at 45,109,242 bp
  • A to G, chromosome 16 at 3,839,302 bp
  • T to A, chromosome 16 at 36,898,546 bp
  • G to T, chromosome 17 at 25,373,210 bp
  • T to A, chromosome 18 at 50,155,185 bp
  • A to G, chromosome 18 at 61,989,506 bp
  • A to T, chromosome 18 at 90,591,100 bp
  • T to A, chromosome 19 at 37,420,341 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7367 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045451-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.