Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7368Btlr/Mmmh
Stock Number:
045452-MU
Citation ID:
RRID:MMRRC_045452-MU
Other Names:
R7368 (G1)
Major Collection:

Strain Information

Ednrb
Name: endothelin receptor type B
Synonyms: ETb, Sox10m1, ETR-b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13618
VEGA: 14
HGNC: HGNC:3180
Homologene: 89
Kitl
Name: kit ligand
Synonyms: SF, stem cell factor, Steel factor, SLF, Mgf, Sl, Gb, grizzle-belly, Steel, SCF, Kitlg, blz
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17311
HGNC: HGNC:6343
Homologene: 692
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Fkbp11
Name: FK506 binding protein 11
Synonyms: 1110002O23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66120
VEGA: 15
Homologene: 9581
Epha7
Name: Eph receptor A7
Synonyms: MDK1, Ebk, Cek11, Ehk3, Hek11, Mdk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13841
HGNC: HGNC:3390
Homologene: 20935
Cyrib
Name: CYFIP related Rac1 interactor B
Synonyms: 0910001A06Rik, Fam49b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223601
VEGA: 15
Homologene: 9599
Hdac5
Name: histone deacetylase 5
Synonyms: mHDA1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15184
Homologene: 3995
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 125,584,519 bp
  • C to A, chromosome 1 at 151,193,096 bp
  • T to C, chromosome 2 at 9,916,377 bp
  • A to G, chromosome 2 at 86,959,258 bp
  • A to G, chromosome 2 at 181,782,591 bp
  • C to T, chromosome 4 at 28,871,937 bp
  • T to C, chromosome 4 at 57,221,993 bp
  • T to A, chromosome 4 at 82,966,144 bp
  • T to C, chromosome 4 at 116,573,458 bp
  • CGG to CG, chromosome 4 at 120,097,911 bp
  • T to A, chromosome 4 at 130,127,385 bp
  • T to A, chromosome 6 at 30,551,990 bp
  • A to T, chromosome 6 at 50,348,098 bp
  • G to C, chromosome 6 at 72,616,278 bp
  • A to G, chromosome 6 at 83,929,455 bp
  • G to T, chromosome 6 at 134,450,818 bp
  • T to C, chromosome 7 at 32,334,567 bp
  • T to C, chromosome 7 at 120,029,016 bp
  • A to T, chromosome 7 at 126,468,513 bp
  • T to A, chromosome 8 at 61,089,707 bp
  • C to T, chromosome 8 at 94,476,393 bp
  • C to T, chromosome 8 at 105,690,835 bp
  • TAGTAGCAGCAGCAGTAGCAGCAGCAG to TAGTAGCAGCAGCAG, chromosome 8 at 105,888,405 bp
  • G to A, chromosome 9 at 7,577,317 bp
  • G to A, chromosome 9 at 58,151,260 bp
  • C to A, chromosome 9 at 67,914,073 bp
  • C to A, chromosome 9 at 87,730,697 bp
  • T to C, chromosome 10 at 76,400,001 bp
  • C to T, chromosome 10 at 78,182,480 bp
  • A to T, chromosome 10 at 100,016,081 bp
  • T to C, chromosome 10 at 123,196,893 bp
  • G to A, chromosome 10 at 127,295,907 bp
  • G to A, chromosome 11 at 7,144,765 bp
  • A to C, chromosome 11 at 41,976,563 bp
  • C to A, chromosome 11 at 58,048,078 bp
  • G to T, chromosome 11 at 60,490,915 bp
  • C to T, chromosome 11 at 82,942,495 bp
  • T to A, chromosome 11 at 84,167,472 bp
  • A to T, chromosome 11 at 102,197,381 bp
  • A to G, chromosome 11 at 104,187,604 bp
  • T to C, chromosome 11 at 116,679,979 bp
  • A to T, chromosome 12 at 84,612,865 bp
  • T to C, chromosome 13 at 49,661,219 bp
  • C to T, chromosome 13 at 63,511,984 bp
  • T to A, chromosome 13 at 67,257,236 bp
  • C to A, chromosome 13 at 97,996,862 bp
  • A to T, chromosome 14 at 24,467,076 bp
  • T to A, chromosome 14 at 55,870,511 bp
  • C to T, chromosome 14 at 57,017,316 bp
  • T to C, chromosome 14 at 59,280,725 bp
  • A to G, chromosome 14 at 72,480,056 bp
  • T to A, chromosome 14 at 103,820,017 bp
  • A to T, chromosome 15 at 63,938,658 bp
  • T to C, chromosome 15 at 77,735,934 bp
  • T to C, chromosome 15 at 98,724,426 bp
  • T to C, chromosome 15 at 101,846,872 bp
  • A to G, chromosome 16 at 96,643,931 bp
  • A to G, chromosome 17 at 18,136,278 bp
  • A to G, chromosome 17 at 73,827,462 bp
  • A to G, chromosome 19 at 3,620,085 bp
  • A to T, chromosome 19 at 5,336,663 bp
  • G to A, chromosome 19 at 11,590,073 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7368 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045452-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.