Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7372Btlr/Mmmh
Stock Number:
045455-MU
Citation ID:
RRID:MMRRC_045455-MU
Other Names:
R7372 (G1)
Major Collection:

Strain Information

Kif3c
Name: kinesin family member 3C
Synonyms: N-4 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16570
VEGA: 12
HGNC: HGNC:6321
Homologene: 55640
Crhr1
Name: corticotropin releasing hormone receptor 1
Synonyms: CRFR1, CRF-R1alpha, CRF 1 receptor, CRF1R
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12921
Homologene: 20920
Ctnnal1
Name: catenin alpha like 1
Synonyms: ACRP, Catnal1, catenin (cadherin associated protein), alpha-like 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54366
HGNC: HGNC:2512
Homologene: 2815
Pnn
Name: pinin
Synonyms: D12Ertd512e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18949
VEGA: 12
HGNC: HGNC:9162
Homologene: 37656
Gnl3
Name: guanine nucleotide binding protein nucleolar 3
Synonyms: nucleostemin, NS
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30877
VEGA: 14
Homologene: 56670
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Cryzl1
Name: crystallin zeta like 1
Synonyms: 2210407J23Rik, 2410006O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66609
HGNC: HGNC:2420
Homologene: 3749
Prtg
Name: protogenin
Synonyms: A230098A12Rik, Igdcc5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235472
Homologene: 54453
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Prr11
Name: proline rich 11
Synonyms: B930067F20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 270906
Homologene: 10123
Dek
Name: DEK proto-oncogene
Synonyms: D13H6S231E, 1810019E15Rik, DEK proto-oncogene (DNA binding)
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110052
HGNC: HGNC:2768
Homologene: 2593
Pold1
Name: polymerase (DNA directed), delta 1, catalytic subunit
Synonyms: 125kDa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18971
HGNC: HGNC:9175
Homologene: 2014
Rasgrp1
Name: RAS guanyl releasing protein 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19419
HGNC: HGNC:9878
Homologene: 4195
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: Znf295, 5430437K12Rik, B430213I24Rik, Zfp295
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114565
VEGA: 16
Homologene: 10799
Iqsec3
Name: IQ motif and Sec7 domain 3
Synonyms: BRAG3, synarfGEF
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243621
Homologene: 46091
Ypel3
Name: yippee like 3
Synonyms: 1190001G19Rik, Suap, 0610043B10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66090
Homologene: 116010
Glipr2
Name: GLI pathogenesis-related 2
Synonyms: GAPR-1, 5730414A08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 384009
Homologene: 74720
Cd209a
Name: CD209a antigen
Synonyms: CIRE, CD209, Dcsign, DC-SIGN1, DC-SIGN, SIGNR5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170786
HGNC: HGNC:1641
Homologene: 129771
Adarb1
Name: adenosine deaminase, RNA-specific, B1
Synonyms: RED1, ADAR2, D10Bwg0447e, 1700057H01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 110532
HGNC: HGNC:226
Homologene: 8280
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Snx13
Name: sorting nexin 13
Synonyms: RGS-PX1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217463
VEGA: 12
Homologene: 41011
Gpn1
Name: GPN-loop GTPase 1
Synonyms: 2410004J02Rik, Xab1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74254
Homologene: 5257
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Evc2
Name: EvC ciliary complex subunit 2
Synonyms: limbin, Lbn, Ellis van Creveld syndrome 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68525
Homologene: 17117
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Kif5c
Name: kinesin family member 5C
Synonyms: Khc
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16574
HGNC: HGNC:6325
Homologene: 56234
Trim69
Name: tripartite motif-containing 69
Synonyms: 4921519C19Rik, Trif, Rnf36
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70928
Homologene: 18827
Tppp2
Name: tubulin polymerization-promoting protein family member 2
Synonyms: LOC219038, LOC386487
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219038
VEGA: 14
Homologene: 25079
Hs2st1
Name: heparan sulfate 2-O-sulfotransferase 1
Synonyms: Hs2st
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23908
HGNC: HGNC:5193
Homologene: 8025
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Fscb
Name: fibrous sheath CABYR binding protein
Synonyms: EG623046
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 623046
VEGA: 12
Homologene: 136275
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Tbc1d9b
Name: TBC1 domain family, member 9B
Synonyms: 2700008N14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76795
Homologene: 28106
Atrnl1
Name: attractin like 1
Synonyms: Alp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226255
VEGA: 19
Homologene: 45809
Pik3cg
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma
Synonyms: PI3Kgamma, p110gamma, PI3Kgamma, PI(3)Kgamma, 5830428L06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 30955
HGNC: HGNC:8978
Homologene: 68269
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Papolg
Name: poly(A) polymerase gamma
Synonyms: 9630006B20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216578
Homologene: 56959
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
Cckar
Name: cholecystokinin A receptor
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12425
HGNC: HGNC:1570
Homologene: 37337
Spty2d1
Name: SPT2 chromatin protein domain containing 1
Synonyms: 5830435K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101685
Homologene: 45499
Adam6b
Name: a disintegrin and metallopeptidase domain 6B
Synonyms: 4930523C11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238405
Homologene: 128362
Camk4
Name: calcium/calmodulin-dependent protein kinase IV
Synonyms: Ca2+/calmodulin-dependent protein kinase type IV/Gr, CaMKIV/Gr, CaMKIV, A430110E23Rik, D18Bwg0362e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12326
VEGA: 18
HGNC: HGNC:1464
Homologene: 100780
Or5p68
Name: olfactory receptor family 5 subfamily P member 68
Synonyms: GA_x6K02T2PBJ9-10676998-10676054, MOR204-35, Olfr493
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258307
Homologene: 17188
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Vmn2r20
Name: vomeronasal 2, receptor 20
Synonyms: EG667180
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667180
Homologene: 84037
Krt15
Name: keratin 15
Synonyms: K15, Krt1-15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16665
HGNC: HGNC:6421
Homologene: 1712
C2cd2
Name: C2 calcium-dependent domain containing 2
Synonyms: ORF25, 5830404H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207781
VEGA: 16
HGNC: HGNC:1266
Homologene: 18368
Cyp3a41a
Name: cytochrome P450, family 3, subfamily a, polypeptide 41A
Synonyms: steroid inducible, Cyp3a41
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53973
HGNC: HGNC:2638
Homologene: 133568
Brdt
Name: bromodomain, testis-specific
Synonyms: 7420412D09Rik, Brd6, Fsrg3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114642
HGNC: HGNC:1105
Homologene: 21064
Gm340
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mouse
Chromosome: 19
Lrrc32
Name: leucine rich repeat containing 32
Synonyms: D7H11S833E, D11S833Eh, Garp, EG434215
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434215
HGNC: HGNC:4161
Homologene: 4027
Gsdmd
Name: gasdermin D
Synonyms: M2-4, DF5L, 1810036L03Rik, Dfna5l, Gsdmdc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69146
VEGA: 15
Homologene: 12299
Pcdhb20
Name: protocadherin beta 20
Synonyms: Pcdhb14, PcdhbT
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93891
HGNC: HGNC:8685
Homologene: 134303
Prl8a1
Name: prolactin family 8, subfamily a, member 1
Synonyms: PLP-Cd, 1600017L04Rik, 3830403L08Rik, Plpcd, Prlpc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73244
Trim72
Name: tripartite motif-containing 72
Synonyms: MG53, mitsugumin 53
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434246
Homologene: 66924
Acss2
Name: acyl-CoA synthetase short-chain family member 2
Synonyms: acetyl-CoA synthetase 1, ACAS, AceCS1, Acas1, Acs1, Acas2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60525
Homologene: 6469
Dnaaf6rt
Name: dynein axonemal assembly factor 6, retrotransposed
Synonyms: 4930521A18Rik, Pih1d3, Dnaaf6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74708
Homologene: 16553
Zfp189
Name: zinc finger protein 189
Synonyms: C430015I23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230162
Homologene: 20737
Cept1
Name: choline/ethanolaminephosphotransferase 1
Synonyms: 9930118K05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99712
Homologene: 81624
Hemk1
Name: HemK methyltransferase family member 1
Synonyms: 2310008M14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69536
Homologene: 6815
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 31,223,351 bp
  • C to T, chromosome 1 at 93,006,366 bp
  • G to A, chromosome 1 at 156,622,619 bp
  • C to T, chromosome 1 at 174,197,635 bp
  • T to A, chromosome 2 at 49,758,659 bp
  • T to C, chromosome 2 at 76,947,931 bp
  • A to G, chromosome 2 at 117,285,154 bp
  • A to C, chromosome 2 at 122,178,583 bp
  • T to C, chromosome 2 at 155,557,180 bp
  • A to G, chromosome 2 at 181,238,423 bp
  • G to A, chromosome 3 at 38,890,209 bp
  • A to G, chromosome 3 at 106,503,740 bp
  • A to G, chromosome 3 at 117,782,351 bp
  • A to T, chromosome 3 at 144,435,460 bp
  • T to C, chromosome 4 at 43,968,184 bp
  • T to A, chromosome 4 at 49,530,417 bp
  • T to A, chromosome 4 at 56,826,285 bp
  • T to A, chromosome 5 at 31,501,121 bp
  • T to A, chromosome 5 at 37,387,133 bp
  • T to C, chromosome 5 at 53,707,282 bp
  • A to G, chromosome 5 at 107,370,294 bp
  • G to A, chromosome 5 at 144,789,398 bp
  • T to C, chromosome 5 at 145,713,564 bp
  • C to A, chromosome 6 at 121,384,032 bp
  • T to C, chromosome 6 at 122,083,466 bp
  • A to T, chromosome 6 at 123,385,509 bp
  • C to A, chromosome 7 at 44,543,423 bp
  • T to C, chromosome 7 at 46,998,944 bp
  • A to G, chromosome 7 at 98,499,807 bp
  • G to T, chromosome 7 at 104,232,636 bp
  • A to T, chromosome 7 at 104,841,706 bp
  • A to G, chromosome 7 at 108,346,496 bp
  • A to G, chromosome 7 at 126,780,028 bp
  • A to G, chromosome 7 at 128,004,686 bp
  • ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC to ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC, chromosome 7 at 142,165,420 bp
  • T to A, chromosome 8 at 3,748,857 bp
  • C to T, chromosome 9 at 72,851,566 bp
  • T to C, chromosome 9 at 107,337,068 bp
  • A to T, chromosome 9 at 108,110,519 bp
  • T to A, chromosome 10 at 77,295,878 bp
  • A to T, chromosome 10 at 77,690,427 bp
  • A to G, chromosome 11 at 23,866,439 bp
  • A to G, chromosome 11 at 50,168,688 bp
  • A to G, chromosome 11 at 87,098,774 bp
  • A to T, chromosome 11 at 100,135,560 bp
  • A to G, chromosome 11 at 104,163,893 bp
  • T to A, chromosome 12 at 3,387,592 bp
  • C to T, chromosome 12 at 32,197,197 bp
  • A to T, chromosome 12 at 35,078,951 bp
  • T to A, chromosome 12 at 59,068,979 bp
  • G to A, chromosome 12 at 64,471,824 bp
  • T to A, chromosome 12 at 70,056,029 bp
  • T to A, chromosome 12 at 113,490,164 bp
  • A to G, chromosome 12 at 115,495,866 bp
  • T to A, chromosome 13 at 11,680,999 bp
  • A to T, chromosome 13 at 27,574,106 bp
  • T to C, chromosome 13 at 47,105,577 bp
  • T to C, chromosome 14 at 31,016,886 bp
  • C to T, chromosome 14 at 51,919,408 bp
  • T to A, chromosome 15 at 75,865,769 bp
  • T to C, chromosome 16 at 91,712,197 bp
  • A to T, chromosome 16 at 97,875,380 bp
  • C to T, chromosome 16 at 97,950,369 bp
  • T to C, chromosome 17 at 34,717,254 bp
  • T to A, chromosome 17 at 52,894,101 bp
  • A to G, chromosome 18 at 33,185,125 bp
  • A to G, chromosome 18 at 37,506,787 bp
  • T to C, chromosome 19 at 41,585,506 bp
  • T to C, chromosome 19 at 57,935,646 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7372 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045455-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.