Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7372Btlr/Mmmh
Stock Number:
045455-MU
Citation ID:
RRID:MMRRC_045455-MU
Other Names:
R7372 (G1)
Major Collection:

Strain Information

Kif3c
Name: kinesin family member 3C
Synonyms: N-4 kinesin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16570
VEGA: 12
HGNC: HGNC:6321
Homologene: 55640
Crhr1
Name: corticotropin releasing hormone receptor 1
Synonyms: CRFR1, CRF-R1alpha, CRF 1 receptor, CRF1R
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12921
Homologene: 20920
Ctnnal1
Name: catenin alpha like 1
Synonyms: ACRP, Catnal1, catenin (cadherin associated protein), alpha-like 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54366
HGNC: HGNC:2512
Homologene: 2815
Pnn
Name: pinin
Synonyms: D12Ertd512e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18949
VEGA: 12
HGNC: HGNC:9162
Homologene: 37656
Gnl3
Name: guanine nucleotide binding protein nucleolar 3
Synonyms: nucleostemin, NS
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 30877
VEGA: 14
Homologene: 56670
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 31,223,351 bp
  • C to T, chromosome 1 at 93,006,366 bp
  • G to A, chromosome 1 at 156,622,619 bp
  • C to T, chromosome 1 at 174,197,635 bp
  • T to A, chromosome 2 at 49,758,659 bp
  • T to C, chromosome 2 at 76,947,931 bp
  • A to G, chromosome 2 at 117,285,154 bp
  • A to C, chromosome 2 at 122,178,583 bp
  • T to C, chromosome 2 at 155,557,180 bp
  • A to G, chromosome 2 at 181,238,423 bp
  • G to A, chromosome 3 at 38,890,209 bp
  • A to G, chromosome 3 at 106,503,740 bp
  • A to G, chromosome 3 at 117,782,351 bp
  • A to T, chromosome 3 at 144,435,460 bp
  • T to C, chromosome 4 at 43,968,184 bp
  • T to A, chromosome 4 at 49,530,417 bp
  • T to A, chromosome 4 at 56,826,285 bp
  • T to A, chromosome 5 at 31,501,121 bp
  • T to A, chromosome 5 at 37,387,133 bp
  • T to C, chromosome 5 at 53,707,282 bp
  • A to G, chromosome 5 at 107,370,294 bp
  • G to A, chromosome 5 at 144,789,398 bp
  • T to C, chromosome 5 at 145,713,564 bp
  • C to A, chromosome 6 at 121,384,032 bp
  • T to C, chromosome 6 at 122,083,466 bp
  • A to T, chromosome 6 at 123,385,509 bp
  • C to A, chromosome 7 at 44,543,423 bp
  • T to C, chromosome 7 at 46,998,944 bp
  • A to G, chromosome 7 at 98,499,807 bp
  • G to T, chromosome 7 at 104,232,636 bp
  • A to T, chromosome 7 at 104,841,706 bp
  • A to G, chromosome 7 at 108,346,496 bp
  • A to G, chromosome 7 at 126,780,028 bp
  • A to G, chromosome 7 at 128,004,686 bp
  • ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC to ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC, chromosome 7 at 142,165,420 bp
  • T to A, chromosome 8 at 3,748,857 bp
  • C to T, chromosome 9 at 72,851,566 bp
  • T to C, chromosome 9 at 107,337,068 bp
  • A to T, chromosome 9 at 108,110,519 bp
  • T to A, chromosome 10 at 77,295,878 bp
  • A to T, chromosome 10 at 77,690,427 bp
  • A to G, chromosome 11 at 23,866,439 bp
  • A to G, chromosome 11 at 50,168,688 bp
  • A to G, chromosome 11 at 87,098,774 bp
  • A to T, chromosome 11 at 100,135,560 bp
  • A to G, chromosome 11 at 104,163,893 bp
  • T to A, chromosome 12 at 3,387,592 bp
  • C to T, chromosome 12 at 32,197,197 bp
  • A to T, chromosome 12 at 35,078,951 bp
  • T to A, chromosome 12 at 59,068,979 bp
  • G to A, chromosome 12 at 64,471,824 bp
  • T to A, chromosome 12 at 70,056,029 bp
  • T to A, chromosome 12 at 113,490,164 bp
  • A to G, chromosome 12 at 115,495,866 bp
  • T to A, chromosome 13 at 11,680,999 bp
  • A to T, chromosome 13 at 27,574,106 bp
  • T to C, chromosome 13 at 47,105,577 bp
  • T to C, chromosome 14 at 31,016,886 bp
  • C to T, chromosome 14 at 51,919,408 bp
  • T to A, chromosome 15 at 75,865,769 bp
  • T to C, chromosome 16 at 91,712,197 bp
  • A to T, chromosome 16 at 97,875,380 bp
  • C to T, chromosome 16 at 97,950,369 bp
  • T to C, chromosome 17 at 34,717,254 bp
  • T to A, chromosome 17 at 52,894,101 bp
  • A to G, chromosome 18 at 33,185,125 bp
  • A to G, chromosome 18 at 37,506,787 bp
  • T to C, chromosome 19 at 41,585,506 bp
  • T to C, chromosome 19 at 57,935,646 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7372 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045455-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.