Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7376Btlr/Mmmh
Stock Number:
045459-MU
Citation ID:
RRID:MMRRC_045459-MU
Other Names:
R7376 (G1)
Major Collection:

Strain Information

D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Lgi1
Name: leucine-rich repeat LGI family, member 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56839
HGNC: HGNC:6572
Homologene: 3737
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Mrps18b
Name: mitochondrial ribosomal protein S18B
Synonyms: 2400002C15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66973
Homologene: 32205
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,192,689 bp
  • T to G, chromosome 1 at 91,322,314 bp
  • A to G, chromosome 1 at 99,967,269 bp
  • A to T, chromosome 1 at 119,910,014 bp
  • C to T, chromosome 1 at 158,251,368 bp
  • A to G, chromosome 1 at 181,763,402 bp
  • T to A, chromosome 2 at 30,406,465 bp
  • A to G, chromosome 2 at 34,204,877 bp
  • G to T, chromosome 2 at 129,119,073 bp
  • A to G, chromosome 2 at 142,711,872 bp
  • G to A, chromosome 2 at 163,082,593 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • A to G, chromosome 4 at 126,590,637 bp
  • A to G, chromosome 4 at 153,983,052 bp
  • T to G, chromosome 5 at 36,813,378 bp
  • T to C, chromosome 5 at 37,370,639 bp
  • G to A, chromosome 5 at 52,538,262 bp
  • A to G, chromosome 5 at 81,794,750 bp
  • A to G, chromosome 5 at 106,895,218 bp
  • G to T, chromosome 5 at 136,990,481 bp
  • T to C, chromosome 5 at 137,758,152 bp
  • C to T, chromosome 5 at 140,898,238 bp
  • T to C, chromosome 6 at 38,174,303 bp
  • A to G, chromosome 6 at 55,073,359 bp
  • T to C, chromosome 6 at 57,258,357 bp
  • T to C, chromosome 6 at 85,622,106 bp
  • C to T, chromosome 6 at 88,849,650 bp
  • A to T, chromosome 6 at 113,290,013 bp
  • G to A, chromosome 6 at 124,832,575 bp
  • G to T, chromosome 7 at 21,349,743 bp
  • A to G, chromosome 7 at 42,195,207 bp
  • T to G, chromosome 7 at 79,088,307 bp
  • T to C, chromosome 7 at 127,476,577 bp
  • G to T, chromosome 7 at 133,013,968 bp
  • A to G, chromosome 7 at 141,872,550 bp
  • T to C, chromosome 8 at 80,726,051 bp
  • T to A, chromosome 8 at 121,974,497 bp
  • A to G, chromosome 9 at 37,432,916 bp
  • C to T, chromosome 9 at 108,580,792 bp
  • T to A, chromosome 10 at 3,545,690 bp
  • C to T, chromosome 10 at 62,559,064 bp
  • T to C, chromosome 10 at 79,478,956 bp
  • G to A, chromosome 10 at 89,809,656 bp
  • A to G, chromosome 10 at 111,299,250 bp
  • A to G, chromosome 11 at 9,291,118 bp
  • A to T, chromosome 11 at 60,261,200 bp
  • T to A, chromosome 11 at 62,118,252 bp
  • C to A, chromosome 11 at 116,360,366 bp
  • A to G, chromosome 13 at 38,172,843 bp
  • T to A, chromosome 13 at 81,518,126 bp
  • G to A, chromosome 15 at 11,277,339 bp
  • A to G, chromosome 15 at 31,235,839 bp
  • T to C, chromosome 16 at 56,724,979 bp
  • A to T, chromosome 16 at 58,925,758 bp
  • A to G, chromosome 17 at 35,910,695 bp
  • T to A, chromosome 18 at 63,777,620 bp
  • C to T, chromosome 19 at 27,394,328 bp
  • G to A, chromosome 19 at 38,284,020 bp
  • C to T, chromosome 19 at 44,555,355 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7376 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045459-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.