Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7376Btlr/Mmmh
Stock Number:
045459-MU
Citation ID:
RRID:MMRRC_045459-MU
Other Names:
R7376 (G1)
Major Collection:

Strain Information

D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Card11
Name: caspase recruitment domain family, member 11
Synonyms: CARMA1, BIMP3, 2410011D02Rik, 0610008L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108723
Homologene: 13024
Lgi1
Name: leucine-rich repeat LGI family, member 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56839
HGNC: HGNC:6572
Homologene: 3737
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Mrps18b
Name: mitochondrial ribosomal protein S18B
Synonyms: 2400002C15Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66973
Homologene: 32205
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Mybl2
Name: myeloblastosis oncogene-like 2
Synonyms: Bmyb, B-Myb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17865
HGNC: HGNC:7548
Homologene: 1847
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Gars1
Name: glycyl-tRNA synthetase 1
Synonyms: Sgrp23, GENA202, Gena201, Gars
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Cep104
Name: centrosomal protein 104
Synonyms: BC046331
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230967
Homologene: 44919
Banp
Name: BTG3 associated nuclear protein
Synonyms: SMAR1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 53325
Homologene: 9635
Kifbp
Name: kinesin family binding protein
Synonyms: 2510003E04Rik, Kif1bp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72320
Homologene: 9223
Tom1l2
Name: target of myb1-like 2 (chicken)
Synonyms: 2900016I08Rik, myb1-like protein 2, A730055F12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216810
Homologene: 44901
Bltp3b
Name: bridge-like lipid transfer protein family member 3B
Synonyms: 4930506D01Rik, 2010319N22Rik, E030041M21Rik, Uhrf1bp1l
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75089
VEGA: 10
Homologene: 12590
Wdr7
Name: WD repeat domain 7
Synonyms: TGF-beta resistance associated gene, TRAG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Dsp
Name: desmoplakin
Synonyms: DP, 2300002E22Rik, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Podxl2
Name: podocalyxin-like 2
Synonyms: PODLX2, D130074J02Rik, Endoglycan
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319655
Homologene: 9254
Alms1
Name: ALMS1, centrosome and basal body associated
Synonyms: Alstrom syndrome 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 236266
HGNC: HGNC:428
Homologene: 49406
Adamts12
Name: ADAM metallopeptidase with thrombospondin type 1 motif 12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239337
VEGA: 15
Homologene: 12808
Pum3
Name: pumilio RNA-binding family member 3
Synonyms: 1110069H02Rik, D19Bwg1357e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52874
VEGA: 19
Homologene: 5762
Tsc22d4
Name: Tsc22 domain family, member 4
Synonyms: Thg-1pit, 0610009M14Rik, 1700023B23Rik, Tsc22d4, Spacdr
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78829
Homologene: 11390
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Rnf157
Name: ring finger protein 157
Synonyms: A130073L17Rik, 2610036E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217340
Homologene: 28235
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Evc2
Name: EvC ciliary complex subunit 2
Synonyms: limbin, Lbn, Ellis van Creveld syndrome 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68525
Homologene: 17117
Clspn
Name: claspin
Synonyms: E130314M08Rik, C85083
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269582
Homologene: 11138
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Hfm1
Name: HFM1, ATP-dependent DNA helicase homolog
Synonyms: LOC381663, A330009G12Rik, Sec63d1, Mer3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330149
Homologene: 87103
Specc1
Name: sperm antigen with calponin homology and coiled-coil domains 1
Synonyms: 2810012G08Rik, B230396K10Rik, Cytsb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432572
Homologene: 45157
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Vmn2r83
Name: vomeronasal 2, receptor 83
Synonyms: EG625029
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625029
Homologene: 83669
Bbs10
Name: Bardet-Biedl syndrome 10
Synonyms: 1300007O09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71769
VEGA: 10
Homologene: 49781
Espnl
Name: espin-like
Synonyms: LOC227357
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227357
Homologene: 77795
Tmem177
Name: transmembrane protein 177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66343
Homologene: 12732
Crat
Name: carnitine acetyltransferase
Synonyms: CARAT
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12908
HGNC: HGNC:2342
Homologene: 598
Cpne9
Name: copine family member IX
Synonyms: A730016F12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211232
Homologene: 84686
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: Caspr5-2, C230078M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241175
Homologene: 104295
Cdca3
Name: cell division cycle associated 3
Synonyms: 2410005A12Rik, TOME-1, Grcc8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14793
Homologene: 8403
Smarca5
Name: SNF2 related chromatin remodeling ATPase 5
Synonyms: Snf2h, D330027N15Rik, 4933427E24Rik, D030040M08Rik, MommeD4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93762
Homologene: 55764
Acan
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Pbx3
Name: pre B cell leukemia homeobox 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18516
HGNC: HGNC:8634
Homologene: 21243
Vmn2r60
Name: vomeronasal 2, receptor 60
Synonyms: Casr-rs3, EG637898, Gprc2a-rs3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637898
Homologene: 129683
Brinp2
Name: bone morphogenic protein/retinoic acid inducible neural-specific 2
Synonyms: 6430517E21Rik, Fam5b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240843
Homologene: 10905
Lgi2
Name: leucine-rich repeat LGI family, member 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246316
Homologene: 10048
Ndufb8
Name: NADH:ubiquinone oxidoreductase subunit B8
Synonyms: 2900010I05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67264
HGNC: HGNC:7703
Homologene: 3668
Man2b2
Name: mannosidase 2, alpha B2
Synonyms: 135 kDa alpha-D-mannosidase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17160
Homologene: 7411
Vmn1r15
Name: vomeronasal 1 receptor 15
Synonyms: V1rc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113863
Homologene: 123826
Plod3
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonyms: lysyl hydroxylase 3, LH3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26433
HGNC: HGNC:9083
Homologene: 843
Or5k17
Name: olfactory receptor family 5 subfamily K member 17
Synonyms: GA_x54KRFPKG5P-55145984-55145034, MOR184-4, Olfr181
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259001
Homologene: 74112
Iyd
Name: iodotyrosine deiodinase
Synonyms: 0610009A07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70337
Homologene: 12352
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: 9130020O16Rik, Gpr128
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239853
Homologene: 13115
Dap
Name: death-associated protein
Synonyms: 4921531N22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223453
HGNC: HGNC:2672
Homologene: 3235
Vmn1r128
Name: vomeronasal 1 receptor 128
Synonyms: Gm8509
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667199
Homologene: 104166
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,192,689 bp
  • T to G, chromosome 1 at 91,322,314 bp
  • A to G, chromosome 1 at 99,967,269 bp
  • A to T, chromosome 1 at 119,910,014 bp
  • C to T, chromosome 1 at 158,251,368 bp
  • A to G, chromosome 1 at 181,763,402 bp
  • T to A, chromosome 2 at 30,406,465 bp
  • A to G, chromosome 2 at 34,204,877 bp
  • G to T, chromosome 2 at 129,119,073 bp
  • A to G, chromosome 2 at 142,711,872 bp
  • G to A, chromosome 2 at 163,082,593 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • A to G, chromosome 4 at 126,590,637 bp
  • A to G, chromosome 4 at 153,983,052 bp
  • T to G, chromosome 5 at 36,813,378 bp
  • T to C, chromosome 5 at 37,370,639 bp
  • G to A, chromosome 5 at 52,538,262 bp
  • A to G, chromosome 5 at 81,794,750 bp
  • A to G, chromosome 5 at 106,895,218 bp
  • G to T, chromosome 5 at 136,990,481 bp
  • T to C, chromosome 5 at 137,758,152 bp
  • C to T, chromosome 5 at 140,898,238 bp
  • T to C, chromosome 6 at 38,174,303 bp
  • A to G, chromosome 6 at 55,073,359 bp
  • T to C, chromosome 6 at 57,258,357 bp
  • T to C, chromosome 6 at 85,622,106 bp
  • C to T, chromosome 6 at 88,849,650 bp
  • A to T, chromosome 6 at 113,290,013 bp
  • G to A, chromosome 6 at 124,832,575 bp
  • G to T, chromosome 7 at 21,349,743 bp
  • A to G, chromosome 7 at 42,195,207 bp
  • T to G, chromosome 7 at 79,088,307 bp
  • T to C, chromosome 7 at 127,476,577 bp
  • G to T, chromosome 7 at 133,013,968 bp
  • A to G, chromosome 7 at 141,872,550 bp
  • T to C, chromosome 8 at 80,726,051 bp
  • T to A, chromosome 8 at 121,974,497 bp
  • A to G, chromosome 9 at 37,432,916 bp
  • C to T, chromosome 9 at 108,580,792 bp
  • T to A, chromosome 10 at 3,545,690 bp
  • C to T, chromosome 10 at 62,559,064 bp
  • T to C, chromosome 10 at 79,478,956 bp
  • G to A, chromosome 10 at 89,809,656 bp
  • A to G, chromosome 10 at 111,299,250 bp
  • A to G, chromosome 11 at 9,291,118 bp
  • A to T, chromosome 11 at 60,261,200 bp
  • T to A, chromosome 11 at 62,118,252 bp
  • C to A, chromosome 11 at 116,360,366 bp
  • A to G, chromosome 13 at 38,172,843 bp
  • T to A, chromosome 13 at 81,518,126 bp
  • G to A, chromosome 15 at 11,277,339 bp
  • A to G, chromosome 15 at 31,235,839 bp
  • T to C, chromosome 16 at 56,724,979 bp
  • A to T, chromosome 16 at 58,925,758 bp
  • A to G, chromosome 17 at 35,910,695 bp
  • T to A, chromosome 18 at 63,777,620 bp
  • C to T, chromosome 19 at 27,394,328 bp
  • G to A, chromosome 19 at 38,284,020 bp
  • C to T, chromosome 19 at 44,555,355 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7376 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045459-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text