Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7394Btlr/Mmmh
Stock Number:
045476-MU
Citation ID:
RRID:MMRRC_045476-MU
Other Names:
R7394 (G1)
Major Collection:

Strain Information

Cd4
Name: CD4 antigen
Synonyms: L3T4, Ly-4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12504
HGNC: HGNC:1678
Homologene: 513
Cd74
Name: CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)
Synonyms: CLIP, Ii
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16149
VEGA: 18
HGNC: HGNC:1697
Homologene: 3209
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, D14Ggc1e, Mmot1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Snta1
Name: syntrophin, acidic 1
Synonyms: alpha1-syntrophin, Snt1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20648
Homologene: 2331
Cenpv
Name: centromere protein V
Synonyms: 3110013H01Rik, Prr6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73139
Homologene: 42965
Cdyl2
Name: chromodomain protein, Y chromosome-like 2
Synonyms: 1700029M19Rik, 4930453I21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75796
Homologene: 41779
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 170,248,147 bp
  • T to C, chromosome 1 at 188,911,416 bp
  • A to G, chromosome 2 at 15,695,199 bp
  • C to T, chromosome 2 at 69,299,867 bp
  • C to T, chromosome 2 at 89,170,361 bp
  • G to T, chromosome 2 at 111,499,896 bp
  • C to T, chromosome 2 at 122,685,304 bp
  • A to G, chromosome 2 at 154,376,860 bp
  • T to A, chromosome 3 at 126,936,653 bp
  • A to C, chromosome 3 at 135,613,697 bp
  • T to C, chromosome 4 at 32,821,298 bp
  • T to C, chromosome 4 at 43,499,532 bp
  • G to A, chromosome 4 at 61,594,398 bp
  • A to T, chromosome 4 at 96,316,440 bp
  • T to A, chromosome 4 at 118,593,137 bp
  • A to T, chromosome 5 at 34,751,618 bp
  • G to T, chromosome 5 at 67,352,766 bp
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp
  • C to A, chromosome 5 at 96,712,450 bp
  • A to G, chromosome 6 at 66,553,189 bp
  • C to T, chromosome 6 at 85,622,223 bp
  • C to T, chromosome 6 at 90,345,333 bp
  • T to A, chromosome 6 at 121,386,610 bp
  • C to A, chromosome 6 at 123,139,120 bp
  • T to A, chromosome 6 at 124,873,041 bp
  • T to C, chromosome 7 at 14,111,524 bp
  • G to A, chromosome 7 at 35,429,928 bp
  • T to A, chromosome 7 at 44,858,678 bp
  • G to T, chromosome 7 at 46,066,479 bp
  • C to A, chromosome 7 at 99,767,346 bp
  • T to G, chromosome 7 at 127,534,828 bp
  • A to G, chromosome 8 at 11,446,184 bp
  • G to T, chromosome 8 at 13,595,353 bp
  • A to T, chromosome 8 at 70,618,180 bp
  • T to A, chromosome 8 at 82,990,471 bp
  • G to A, chromosome 8 at 106,265,010 bp
  • A to T, chromosome 8 at 109,556,523 bp
  • A to G, chromosome 8 at 116,624,051 bp
  • T to A, chromosome 9 at 18,988,710 bp
  • C to T, chromosome 9 at 110,630,189 bp
  • C to T, chromosome 9 at 114,491,926 bp
  • T to A, chromosome 9 at 121,767,345 bp
  • T to C, chromosome 9 at 123,173,813 bp
  • C to T, chromosome 10 at 78,182,480 bp
  • T to A, chromosome 10 at 83,502,457 bp
  • A to G, chromosome 10 at 100,609,176 bp
  • T to A, chromosome 10 at 130,180,254 bp
  • T to C, chromosome 11 at 6,419,218 bp
  • T to C, chromosome 11 at 62,536,288 bp
  • C to T, chromosome 11 at 87,766,119 bp
  • T to A, chromosome 12 at 81,214,058 bp
  • A to T, chromosome 13 at 34,910,279 bp
  • T to A, chromosome 13 at 50,470,007 bp
  • C to T, chromosome 13 at 65,044,993 bp
  • A to T, chromosome 14 at 5,945,781 bp
  • T to C, chromosome 14 at 21,038,079 bp
  • T to G, chromosome 14 at 34,043,922 bp
  • T to C, chromosome 14 at 67,237,526 bp
  • A to G, chromosome 15 at 67,111,346 bp
  • C to A, chromosome 15 at 98,856,384 bp
  • A to G, chromosome 15 at 102,219,254 bp
  • T to A, chromosome 16 at 19,195,136 bp
  • G to A, chromosome 17 at 44,085,264 bp
  • T to C, chromosome 17 at 46,591,757 bp
  • T to C, chromosome 17 at 67,717,261 bp
  • A to G, chromosome 18 at 37,448,908 bp
  • A to T, chromosome 18 at 60,803,893 bp
  • C to T, chromosome 18 at 84,088,190 bp
  • G to A, chromosome 19 at 11,590,073 bp
  • G to T, chromosome 19 at 18,670,837 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7394 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045476-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.