Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7420Btlr/Mmmh
Stock Number:
045498-MU
Citation ID:
RRID:MMRRC_045498-MU
Other Names:
R7420 (G1)
Major Collection:

Strain Information

Cd36
Name: CD36 molecule
Synonyms: FAT, fatty acid translocase, Scarb3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12491
HGNC: HGNC:1663
Homologene: 73871
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 252870
Homologene: 2592
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Cmtm7
Name: CKLF-like MARVEL transmembrane domain containing 7
Synonyms: Cklfsf7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102545
VEGA: 9
Homologene: 15882
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Ppp2r5d
Name: protein phosphatase 2, regulatory subunit B', delta
Synonyms: TEG-271, Tex271, B'delta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21770
VEGA: 17
HGNC: HGNC:9312
Homologene: 37661
Sdad1
Name: SDA1 domain containing 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231452
Homologene: 6036
Git2
Name: GIT ArfGAP 2
Synonyms: Cool associated tyrosine phosphorylated-2, Cat-2, ARF GTPase activating protein 2, 5830420E16Rik, B230104M05Rik, 1500036H07Rik, 9630056M03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26431
HGNC: HGNC:4273
Homologene: 41336
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Cd79a
Name: CD79A antigen (immunoglobulin-associated alpha)
Synonyms: mb-1, Iga, Ig alpha, Ly54, Cd79a, Ig-alpha, Ly-54, Igalpha
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12518
HGNC: HGNC:1698
Homologene: 31053
Slc39a11
Name: solute carrier family 39 (metal ion transporter), member 11
Synonyms: 1810074D23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69806
Homologene: 12331
Hk1
Name: hexokinase 1
Synonyms: Hk-1, mHk1-s, Hk1-s
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15275
HGNC: HGNC:4922
Homologene: 100530
Fam135a
Name: family with sequence similarity 135, member A
Synonyms: 4921533L14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68187
Homologene: 32665
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, 2010013B10Rik, A230048G03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Fam13b
Name: family with sequence similarity 13, member B
Synonyms: 2610024E20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225358
VEGA: 18
HGNC: HGNC:1335
Homologene: 9585
Selenop
Name: selenoprotein P
Synonyms: D15Ucla1, selp, Se-P, Sepp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20363
Homologene: 3945
Cep164
Name: centrosomal protein 164
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214552
Homologene: 51110
Bud13
Name: BUD13 homolog
Synonyms: D030060M11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 215051
Homologene: 13102
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Zcchc14
Name: zinc finger, CCHC domain containing 14
Synonyms: Bdg29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 142682
Homologene: 9037
Chia1
Name: chitinase, acidic 1
Synonyms: AMCase, YNL, 2200003E03Rik, Chia
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 81600
Homologene: 75168
Card19
Name: caspase recruitment domain family, member 19
Synonyms: 1110007C09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68480
VEGA: 13
Homologene: 12269
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: LOC380730, Gm884
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Chrnd
Name: cholinergic receptor, nicotinic, delta polypeptide
Synonyms: Achr-4, Acrd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11447
HGNC: HGNC:1965
Homologene: 37340
Shcbp1
Name: Shc SH2-domain binding protein 1
Synonyms: mPAL
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20419
Homologene: 32123
Speg
Name: SPEG complex locus
Synonyms: BPEG, SPEGbeta, SPEGalpha, D1Bwg1450e, SPEG, Apeg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11790
Homologene: 55619
Csn1s2a
Name: casein alpha s2-like A
Synonyms: Csn1s2a, Csng
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12993
Homologene: 7284
Zfp800
Name: zinc finger protein 800
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 627049
Homologene: 18529
Nfe2l1
Name: nuclear factor, erythroid derived 2,-like 1
Synonyms: TCF-11, NRF1, LCR-F1, TCF11, Lcrf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18023
HGNC: HGNC:7781
Homologene: 20685
Or2ag1b
Name: olfactory receptor family 2 subfamily AG member 1B
Synonyms: GA_x6K02T2PBJ9-9067220-9066273, MOR283-9, Olfr694
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258444
Homologene: 79345
Krt82
Name: keratin 82
Synonyms: Krt2-20
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 114566
VEGA: 15
HGNC: HGNC:6459
Homologene: 13200
Vmn2r16
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384220
Homologene: 104825
Adam29
Name: a disintegrin and metallopeptidase domain 29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244486
HGNC: HGNC:207
Homologene: 8607
Lztr1
Name: leucine-zipper-like transcriptional regulator, 1
Synonyms: TCFL2, 1200003E21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66863
HGNC: HGNC:6742
Homologene: 4925
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Irag1
Name: inositol 1,4,5-triphosphate receptor associated 1
Synonyms: Ris1, Mrvi1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17540
HGNC: HGNC:7237
Homologene: 4425
Krt15
Name: keratin 15
Synonyms: K15, Krt1-15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16665
HGNC: HGNC:6421
Homologene: 1712
Or8b44
Name: olfactory receptor family 8 subfamily B member 44
Synonyms: GA_x6K02T2PVTD-32204729-32205661, MOR165-5, Olfr907
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258801
VEGA: 9
Homologene: 27268
Plekha8
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 8
Synonyms: FAPP2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231999
Homologene: 32284
Mfrp
Name: membrane frizzled-related protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259172
Homologene: 12866
Otud4
Name: OTU domain containing 4
Synonyms: 4930431L18Rik, D8Ertd69e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73945
Homologene: 35370
Pcdhb21
Name: protocadherin beta 21
Synonyms: Pcdhb18, PcdhbU
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93892
Homologene: 134302
Shc3
Name: src homology 2 domain-containing transforming protein C3
Synonyms: ShcC, N-Shc, Rai
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20418
VEGA: 13
Homologene: 7536
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620672
Homologene: 115466
Klhdc8b
Name: kelch domain containing 8B
Synonyms: 4931406O17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78267
Homologene: 45463
Gm4952
Name: predicted gene 4952
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240549
Homologene: 72602
Defa30
Name: defensin, alpha, 30
Synonyms: Gm15284
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100038927
HGNC: HGNC:2764
Homologene: 113382
Hepacam
Name: hepatocyte cell adhesion molecule
Synonyms: 2900042E01Rik, Glialcam
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72927
Homologene: 17652
Prxl2c
Name: peroxiredoxin like 2C
Synonyms: 1110018J18Rik, Aaed1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66129
VEGA: 13
Homologene: 7192
Gm5460
Name: predicted gene 5460
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432838
VEGA: 14
Tmem100
Name: transmembrane protein 100
Synonyms: 1810057C19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67888
Homologene: 10110
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 24,012,486 bp
  • T to A, chromosome 1 at 75,430,905 bp
  • T to A, chromosome 1 at 87,194,821 bp
  • T to C, chromosome 1 at 118,835,939 bp
  • T to C, chromosome 1 at 134,604,497 bp
  • A to G, chromosome 3 at 63,722,857 bp
  • T to A, chromosome 3 at 106,130,664 bp
  • C to G, chromosome 5 at 17,788,274 bp
  • T to C, chromosome 5 at 87,780,006 bp
  • G to A, chromosome 5 at 92,305,737 bp
  • A to G, chromosome 5 at 109,363,870 bp
  • T to C, chromosome 5 at 114,730,370 bp
  • A to G, chromosome 6 at 28,243,719 bp
  • T to C, chromosome 6 at 54,613,194 bp
  • A to T, chromosome 7 at 5,097,688 bp
  • A to T, chromosome 7 at 24,897,546 bp
  • A to G, chromosome 7 at 85,136,736 bp
  • G to A, chromosome 7 at 106,689,020 bp
  • A to T, chromosome 7 at 110,871,473 bp
  • G to A, chromosome 7 at 144,655,641 bp
  • G to A, chromosome 8 at 4,748,737 bp
  • T to A, chromosome 8 at 21,135,455 bp
  • T to A, chromosome 8 at 55,872,898 bp
  • C to A, chromosome 8 at 79,664,108 bp
  • ACCGCCGCCGCCGCCGCC to ACCGCCGCCGCCGCC, chromosome 8 at 121,651,791 bp
  • A to G, chromosome 9 at 37,380,709 bp
  • G to T, chromosome 9 at 38,499,063 bp
  • T to C, chromosome 9 at 44,102,476 bp
  • T to C, chromosome 9 at 45,768,542 bp
  • C to T, chromosome 9 at 46,287,815 bp
  • A to G, chromosome 9 at 108,449,118 bp
  • T to C, chromosome 9 at 114,763,394 bp
  • T to C, chromosome 10 at 62,269,982 bp
  • A to G, chromosome 11 at 66,117,407 bp
  • C to T, chromosome 11 at 69,478,797 bp
  • A to T, chromosome 11 at 80,095,862 bp
  • A to T, chromosome 11 at 90,035,753 bp
  • A to G, chromosome 11 at 96,819,913 bp
  • A to T, chromosome 11 at 100,135,560 bp
  • A to T, chromosome 11 at 103,613,625 bp
  • A to G, chromosome 11 at 110,250,477 bp
  • G to T, chromosome 11 at 113,247,822 bp
  • A to T, chromosome 11 at 116,540,072 bp
  • T to C, chromosome 13 at 49,208,137 bp
  • T to C, chromosome 13 at 51,431,235 bp
  • C to T, chromosome 13 at 64,297,317 bp
  • T to A, chromosome 14 at 34,036,757 bp
  • G to T, chromosome 15 at 3,279,570 bp
  • T to C, chromosome 15 at 101,545,587 bp
  • T to C, chromosome 16 at 8,710,121 bp
  • T to C, chromosome 16 at 17,524,129 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • A to T, chromosome 17 at 46,687,581 bp
  • A to T, chromosome 17 at 78,808,480 bp
  • G to T, chromosome 18 at 34,494,611 bp
  • A to G, chromosome 18 at 37,515,203 bp
  • G to A, chromosome 19 at 12,626,901 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7420 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045498-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text