Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7420Btlr/Mmmh
Stock Number:
045498-MU
Citation ID:
RRID:MMRRC_045498-MU
Other Names:
R7420 (G1)
Major Collection:

Strain Information

Cd36
Name: CD36 molecule
Synonyms: FAT, fatty acid translocase, Scarb3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12491
HGNC: HGNC:1663
Homologene: 73871
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 252870
Homologene: 2592
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Cmtm7
Name: CKLF-like MARVEL transmembrane domain containing 7
Synonyms: Cklfsf7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102545
VEGA: 9
Homologene: 15882
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 24,012,486 bp
  • T to A, chromosome 1 at 75,430,905 bp
  • T to A, chromosome 1 at 87,194,821 bp
  • T to C, chromosome 1 at 118,835,939 bp
  • T to C, chromosome 1 at 134,604,497 bp
  • A to G, chromosome 3 at 63,722,857 bp
  • T to A, chromosome 3 at 106,130,664 bp
  • C to G, chromosome 5 at 17,788,274 bp
  • T to C, chromosome 5 at 87,780,006 bp
  • G to A, chromosome 5 at 92,305,737 bp
  • A to G, chromosome 5 at 109,363,870 bp
  • T to C, chromosome 5 at 114,730,370 bp
  • A to G, chromosome 6 at 28,243,719 bp
  • T to C, chromosome 6 at 54,613,194 bp
  • A to T, chromosome 7 at 5,097,688 bp
  • A to T, chromosome 7 at 24,897,546 bp
  • A to G, chromosome 7 at 85,136,736 bp
  • G to A, chromosome 7 at 106,689,020 bp
  • A to T, chromosome 7 at 110,871,473 bp
  • G to A, chromosome 7 at 144,655,641 bp
  • G to A, chromosome 8 at 4,748,737 bp
  • T to A, chromosome 8 at 21,135,455 bp
  • T to A, chromosome 8 at 55,872,898 bp
  • C to A, chromosome 8 at 79,664,108 bp
  • ACCGCCGCCGCCGCCGCC to ACCGCCGCCGCCGCC, chromosome 8 at 121,651,791 bp
  • A to G, chromosome 9 at 37,380,709 bp
  • G to T, chromosome 9 at 38,499,063 bp
  • T to C, chromosome 9 at 44,102,476 bp
  • T to C, chromosome 9 at 45,768,542 bp
  • C to T, chromosome 9 at 46,287,815 bp
  • A to G, chromosome 9 at 108,449,118 bp
  • T to C, chromosome 9 at 114,763,394 bp
  • T to C, chromosome 10 at 62,269,982 bp
  • A to G, chromosome 11 at 66,117,407 bp
  • C to T, chromosome 11 at 69,478,797 bp
  • A to T, chromosome 11 at 80,095,862 bp
  • A to T, chromosome 11 at 90,035,753 bp
  • A to G, chromosome 11 at 96,819,913 bp
  • A to T, chromosome 11 at 100,135,560 bp
  • A to T, chromosome 11 at 103,613,625 bp
  • A to G, chromosome 11 at 110,250,477 bp
  • G to T, chromosome 11 at 113,247,822 bp
  • A to T, chromosome 11 at 116,540,072 bp
  • T to C, chromosome 13 at 49,208,137 bp
  • T to C, chromosome 13 at 51,431,235 bp
  • C to T, chromosome 13 at 64,297,317 bp
  • T to A, chromosome 14 at 34,036,757 bp
  • G to T, chromosome 15 at 3,279,570 bp
  • T to C, chromosome 15 at 101,545,587 bp
  • T to C, chromosome 16 at 8,710,121 bp
  • T to C, chromosome 16 at 17,524,129 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • A to T, chromosome 17 at 46,687,581 bp
  • A to T, chromosome 17 at 78,808,480 bp
  • G to T, chromosome 18 at 34,494,611 bp
  • A to G, chromosome 18 at 37,515,203 bp
  • G to A, chromosome 19 at 12,626,901 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7420 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045498-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.