Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7436Btlr/Mmmh
Stock Number:
045512-MU
Citation ID:
RRID:MMRRC_045512-MU
Other Names:
R7436 (G1)
Major Collection:

Strain Information

Utrn
Name: utrophin
Synonyms: G-utrophin, Dmdl, DRP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22288
VEGA: 10
Homologene: 21398
Apoa1
Name: apolipoprotein A-I
Synonyms: Apoa-1, Alp-1, Sep-1, Brp-14, Sep2, Lvtw-1, Sep-2, Ltw-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11806
HGNC: HGNC:600
Homologene: 47900
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ube2j2
Name: ubiquitin-conjugating enzyme E2J 2
Synonyms: Ubc6, 2400008G19Rik, 1200007B18Rik, 5730472G04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140499
Homologene: 10975
Phf20l1
Name: PHD finger protein 20-like 1
Synonyms: CGI-72, E130113K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239510
VEGA: 15
Homologene: 9341
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: U5-200KD, HELIC2, A330064G03Rik, Ascc3l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320632
Homologene: 5859
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 20,200,701 bp
  • G to A, chromosome 1 at 86,386,378 bp
  • A to G, chromosome 1 at 91,511,388 bp
  • C to A, chromosome 1 at 155,226,381 bp
  • T to C, chromosome 1 at 184,069,221 bp
  • A to G, chromosome 2 at 32,963,824 bp
  • T to C, chromosome 2 at 86,084,907 bp
  • T to C, chromosome 2 at 104,257,102 bp
  • T to A, chromosome 2 at 104,951,869 bp
  • A to C, chromosome 2 at 122,127,525 bp
  • G to A, chromosome 2 at 127,226,484 bp
  • T to C, chromosome 3 at 98,339,729 bp
  • A to G, chromosome 3 at 98,711,796 bp
  • T to A, chromosome 3 at 103,074,119 bp
  • T to C, chromosome 3 at 136,055,800 bp
  • T to C, chromosome 4 at 26,328,228 bp
  • A to G, chromosome 4 at 45,024,553 bp
  • A to T, chromosome 4 at 52,994,159 bp
  • C to T, chromosome 4 at 123,456,643 bp
  • T to A, chromosome 4 at 137,515,664 bp
  • T to C, chromosome 4 at 154,984,096 bp
  • T to C, chromosome 4 at 155,957,331 bp
  • A to G, chromosome 5 at 72,667,641 bp
  • T to A, chromosome 5 at 72,696,579 bp
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp
  • C to A, chromosome 5 at 115,110,998 bp
  • A to G, chromosome 5 at 120,486,796 bp
  • G to A, chromosome 5 at 137,780,017 bp
  • T to A, chromosome 6 at 57,360,877 bp
  • TGGCCCAGGCCCAGGC to TGGCCCAGGCCCAGGCCCAGGC, chromosome 6 at 83,368,229 bp
  • C to T, chromosome 6 at 115,926,302 bp
  • T to C, chromosome 6 at 148,789,805 bp
  • T to C, chromosome 7 at 4,552,743 bp
  • T to A, chromosome 7 at 12,041,767 bp
  • A to T, chromosome 7 at 27,158,243 bp
  • A to G, chromosome 7 at 42,580,460 bp
  • A to T, chromosome 7 at 140,261,607 bp
  • A to G, chromosome 8 at 22,108,040 bp
  • T to G, chromosome 8 at 24,586,916 bp
  • T to C, chromosome 8 at 110,583,914 bp
  • G to T, chromosome 9 at 39,950,053 bp
  • T to A, chromosome 9 at 46,229,802 bp
  • A to G, chromosome 9 at 107,750,394 bp
  • A to C, chromosome 10 at 12,439,791 bp
  • T to C, chromosome 11 at 54,610,921 bp
  • T to C, chromosome 11 at 74,288,685 bp
  • T to A, chromosome 11 at 75,416,316 bp
  • A to T, chromosome 11 at 84,877,963 bp
  • A to G, chromosome 11 at 88,845,528 bp
  • T to C, chromosome 11 at 101,247,939 bp
  • A to G, chromosome 11 at 102,272,655 bp
  • A to G, chromosome 13 at 33,195,933 bp
  • A to T, chromosome 13 at 48,586,666 bp
  • G to T, chromosome 14 at 26,579,710 bp
  • A to G, chromosome 14 at 41,983,221 bp
  • A to T, chromosome 14 at 95,882,591 bp
  • A to G, chromosome 15 at 4,941,554 bp
  • G to T, chromosome 15 at 66,597,750 bp
  • A to T, chromosome 15 at 76,268,368 bp
  • C to T, chromosome 16 at 31,976,029 bp
  • T to A, chromosome 16 at 48,951,989 bp
  • A to G, chromosome 16 at 88,759,354 bp
  • T to C, chromosome 17 at 23,610,005 bp
  • T to C, chromosome 17 at 32,909,157 bp
  • A to T, chromosome 17 at 36,943,349 bp
  • T to A, chromosome 17 at 78,768,533 bp
  • T to C, chromosome 18 at 37,309,275 bp
  • A to G, chromosome 19 at 10,582,332 bp
  • C to T, chromosome 19 at 45,553,057 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7436 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045512-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.