Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7438Btlr/Mmmh
Stock Number:
045514-MU
Citation ID:
RRID:MMRRC_045514-MU
Other Names:
R7438 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Becn1
Name: beclin 1, autophagy related
Synonyms: Atg6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56208
HGNC: HGNC:1034
Homologene: 2794
Ncoa3
Name: nuclear receptor coactivator 3
Synonyms: pCIP, TRAM-1, AIB1, RAC3, TRAM1, Src3, 2010305B15Rik, KAT13B, bHLHe42
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17979
HGNC: HGNC:7670
Homologene: 4764
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Rnd1
Name: Rho family GTPase 1
Synonyms: Arhs, A830014L09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223881
Homologene: 8706
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 74,585,520 bp
  • T to A, chromosome 1 at 83,192,715 bp
  • T to C, chromosome 1 at 86,745,500 bp
  • T to A, chromosome 1 at 182,598,675 bp
  • T to A, chromosome 1 at 192,846,710 bp
  • A to T, chromosome 2 at 61,804,817 bp
  • C to T, chromosome 2 at 66,547,187 bp
  • T to A, chromosome 2 at 111,369,362 bp
  • T to A, chromosome 2 at 166,068,529 bp
  • C to T, chromosome 3 at 82,842,488 bp
  • T to A, chromosome 3 at 103,346,640 bp
  • T to C, chromosome 4 at 104,861,429 bp
  • T to A, chromosome 4 at 113,238,228 bp
  • T to C, chromosome 4 at 143,655,560 bp
  • G to A, chromosome 4 at 155,000,460 bp
  • G to T, chromosome 5 at 30,666,948 bp
  • A to T, chromosome 5 at 62,749,475 bp
  • T to A, chromosome 5 at 65,652,535 bp
  • T to A, chromosome 5 at 75,639,000 bp
  • C to A, chromosome 5 at 114,415,284 bp
  • A to C, chromosome 5 at 114,418,626 bp
  • T to C, chromosome 5 at 135,982,705 bp
  • T to G, chromosome 5 at 137,425,562 bp
  • A to T, chromosome 5 at 145,865,900 bp
  • A to G, chromosome 5 at 149,619,020 bp
  • A to T, chromosome 6 at 5,115,378 bp
  • A to T, chromosome 6 at 5,289,080 bp
  • TGGCCCAGGCCCAGGC to TGGCCCAGGCCCAGGCCCAGGC, chromosome 6 at 83,368,229 bp
  • T to A, chromosome 6 at 113,115,082 bp
  • G to A, chromosome 6 at 115,559,982 bp
  • C to T, chromosome 6 at 115,926,302 bp
  • A to G, chromosome 6 at 148,933,102 bp
  • C to T, chromosome 7 at 30,235,221 bp
  • T to A, chromosome 7 at 56,103,718 bp
  • T to A, chromosome 7 at 105,754,948 bp
  • A to G, chromosome 7 at 118,195,893 bp
  • C to A, chromosome 7 at 122,117,331 bp
  • A to G, chromosome 8 at 55,871,574 bp
  • G to T, chromosome 8 at 72,707,830 bp
  • G to T, chromosome 8 at 111,918,408 bp
  • G to A, chromosome 8 at 119,748,197 bp
  • G to A, chromosome 8 at 119,870,175 bp
  • A to G, chromosome 9 at 15,988,482 bp
  • A to G, chromosome 9 at 66,394,756 bp
  • G to T, chromosome 9 at 70,573,466 bp
  • T to A, chromosome 9 at 119,945,539 bp
  • C to T, chromosome 10 at 4,558,512 bp
  • C to T, chromosome 10 at 7,712,942 bp
  • C to T, chromosome 10 at 62,430,470 bp
  • T to A, chromosome 10 at 80,069,575 bp
  • C to A, chromosome 11 at 3,998,227 bp
  • A to G, chromosome 11 at 69,104,735 bp
  • A to G, chromosome 11 at 70,683,888 bp
  • A to G, chromosome 11 at 86,725,228 bp
  • A to G, chromosome 11 at 100,258,465 bp
  • A to C, chromosome 11 at 101,294,226 bp
  • G to T, chromosome 11 at 101,376,677 bp
  • T to C, chromosome 11 at 104,643,577 bp
  • C to T, chromosome 11 at 107,662,030 bp
  • C to T, chromosome 12 at 3,427,108 bp
  • T to A, chromosome 12 at 9,022,785 bp
  • A to G, chromosome 12 at 76,015,563 bp
  • A to T, chromosome 12 at 87,241,931 bp
  • C to A, chromosome 12 at 100,061,726 bp
  • T to C, chromosome 12 at 114,764,475 bp
  • A to G, chromosome 13 at 12,478,457 bp
  • C to T, chromosome 13 at 42,154,911 bp
  • T to C, chromosome 13 at 67,748,945 bp
  • C to T, chromosome 14 at 60,300,304 bp
  • G to A, chromosome 14 at 74,757,037 bp
  • T to C, chromosome 14 at 118,616,446 bp
  • A to T, chromosome 15 at 28,346,952 bp
  • A to G, chromosome 15 at 76,004,426 bp
  • G to T, chromosome 15 at 78,525,374 bp
  • G to A, chromosome 15 at 82,115,481 bp
  • A to G, chromosome 15 at 90,993,796 bp
  • A to T, chromosome 15 at 98,673,901 bp
  • C to T, chromosome 16 at 29,441,196 bp
  • C to A, chromosome 16 at 37,868,691 bp
  • A to T, chromosome 16 at 59,216,398 bp
  • A to T, chromosome 17 at 6,198,708 bp
  • T to C, chromosome 17 at 24,677,530 bp
  • A to G, chromosome 17 at 25,249,108 bp
  • A to G, chromosome 17 at 48,258,470 bp
  • A to G, chromosome 17 at 64,133,521 bp
  • G to A, chromosome 18 at 20,466,628 bp
  • A to T, chromosome 19 at 42,189,520 bp
  • T to A, chromosome 19 at 60,857,361 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7438 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045514-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.