Strain Name:
C57BL/6J-MtgxR7438Btlr/Mmmh
Stock Number:
045514-MU
Citation ID:
RRID:MMRRC_045514-MU
Other Names:
R7438 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: SCO1, Steel Factor Receptor, belly-spot, SCO5, Tr-kit, Dominant white spotting, Gsfsco1, SOW3, c-KIT, CD117, Gsfsco5, Gsfsow3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Becn1
Name: beclin 1, autophagy related
Synonyms: Atg6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56208
HGNC: HGNC:1034
Homologene: 2794
Ncoa3
Name: nuclear receptor coactivator 3
Synonyms: AIB1, TRAM-1, TRAM1, pCIP, bHLHe42, Src3, KAT13B, 2010305B15Rik, RAC3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17979
HGNC: HGNC:7670
Homologene: 4764
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 2810430P21Rik, A230094E16Rik, Neurabin I, 4930518N04Rik, neurabin-I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Rnd1
Name: Rho family GTPase 1
Synonyms: A830014L09Rik, Arhs
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223881
Homologene: 8706
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Asxl2
Name: ASXL transcriptional regulator 2
Synonyms: 4930556B16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75302
Homologene: 10102
Pds5a
Name: PDS5 cohesin associated factor A
Synonyms: 9030416H16Rik, E230024D05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71521
Homologene: 22877
Sbno2
Name: strawberry notch 2
Synonyms: Stno
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216161
VEGA: 10
Homologene: 8981
Helz
Name: helicase with zinc finger domain
Synonyms: 9430093I07Rik, 3110078M01Rik, 9630002H22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Dis3l2
Name: DIS3 like 3'-5' exoribonuclease 2
Synonyms: 4930429A22Rik, 8030493P09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208718
Homologene: 62417
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: 5430435M13Rik, C130002K18Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: rjs, D7H15F37S1, D15F32S1h, D7H15F32S1, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: MOAT-B, D630049P08Rik, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Arap2
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
Synonyms: Centd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212285
Homologene: 9064
Fer
Name: FER tyrosine kinase
Synonyms: C330004K01Rik, Fert2, Fert
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14158
VEGA: 17
HGNC: HGNC:3655
Homologene: 74300
Palb2
Name: partner and localizer of BRCA2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233826
Homologene: 11652
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Sltm
Name: SAFB-like, transcription modulator
Synonyms: 5730555F13Rik, 5730455C01Rik, 9130215G10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66660
VEGA: 9
Homologene: 11696
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Tsen2
Name: tRNA splicing endonuclease subunit 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381802
Homologene: 41622
Vipas39
Name: VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog
Synonyms: Vipar, SPE-39
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104799
VEGA: 12
Homologene: 41464
Cenpa
Name: centromere protein A
Synonyms: Cenp-A, centrosomin A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12615
HGNC: HGNC:1851
Homologene: 1369
Hsph1
Name: heat shock 105kDa/110kDa protein 1
Synonyms: hsp-E7I, HSP110, hsp110/105, Hsp105
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15505
Homologene: 21322
Ift122
Name: intraflagellar transport 122
Synonyms: C86139, sopb, Wdr10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 81896
Homologene: 12819
Tbr1
Name: T-box brain transcription factor 1
Synonyms: T-box brain gene 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21375
Homologene: 4807
Zp3
Name: zona pellucida glycoprotein 3
Synonyms: Zp-3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22788
Homologene: 5178
Itgb3
Name: integrin beta 3
Synonyms: CD61, platelet glycoprotein IIIa (GP3A)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16416
HGNC: HGNC:6156
Homologene: 55444
Sinhcaf
Name: SIN3-HDAC complex associated factor
Synonyms: Fam60a, Pptcs1, Tera
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56306
Homologene: 10494
Ube3b
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117146
Homologene: 13775
Dsg4
Name: desmoglein 4
Synonyms: lah, CDHF13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16769
Homologene: 65341
Edaradd
Name: EDAR associated via death domain
Synonyms: 5830469M23Rik, EDAR (ectodysplasin-A receptor)-associated death domain, 1810032E07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171211
VEGA: 13
Homologene: 15430
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
C1qtnf6
Name: C1q and tumor necrosis factor related protein 6
Synonyms: CTRP6, 2810036M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72709
Homologene: 12481
Pon2
Name: paraoxonase 2
Synonyms: 6330405I24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330260
HGNC: HGNC:9205
Homologene: 385
Per1
Name: period circadian clock 1
Synonyms: m-rigui, mPer1, Hftm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18626
HGNC: HGNC:8845
Homologene: 1966
Zfyve27
Name: zinc finger, FYVE domain containing 27
Synonyms: protrudin, 2210011N02Rik, 9530077C24Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 319740
Homologene: 16939
Zfp142
Name: zinc finger protein 142
Synonyms: 9330177B18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77264
Homologene: 3723
Trim33
Name: tripartite motif-containing 33
Synonyms: ectodermin, Ecto, 8030451N04Rik, Tif1g
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94093
Homologene: 9296
Lrch1
Name: leucine-rich repeats and calponin homology (CH) domain containing 1
Synonyms: 4832412D13Rik, Chdc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380916
VEGA: 14
Homologene: 32244
Tmem231
Name: transmembrane protein 231
Synonyms: 4932417I16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234740
Homologene: 78035
Baiap3
Name: BAI1-associated protein 3
Synonyms: LOC381076
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545192
HGNC: HGNC:948
Homologene: 20844
Sertad4
Name: SERTA domain containing 4
Synonyms: C130018M11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214791
Homologene: 10483
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b1565Clo, b2b3491Clo, Mdnah5, b2b1154Clo, b2b1537Clo, Dnahc5, b2b1134Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Dchs1
Name: dachsous cadherin related 1
Synonyms: 3110041P15Rik, C130033F22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: D12Ertd777e, Cpfl8, dice, 6820443O06Rik, nesprin-2, syne-2, Nesp2g, diminished cone electroretinogram
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Camta2
Name: calmodulin binding transcription activator 2
Synonyms: Kiaa0909-hp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216874
Homologene: 9021
Tet3
Name: tet methylcytosine dioxygenase 3
Synonyms: B430006D22Rik, D230004J03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194388
Homologene: 35360
Fat3
Name: FAT atypical cadherin 3
Synonyms: D430038H04Rik, LOC382129, 9430076A06Rik, LOC234973
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Nwd1
Name: NACHT and WD repeat domain containing 1
Synonyms: A230063L24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319555
Homologene: 72261
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Atp2c2
Name: ATPase, Ca++ transporting, type 2C, member 2
Synonyms: 1810010G06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69047
Homologene: 73463
Scn9a
Name: sodium channel, voltage-gated, type IX, alpha
Synonyms: PN1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20274
Homologene: 2237
C8a
Name: complement component 8, alpha polypeptide
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230558
HGNC: HGNC:1352
Homologene: 472
Rbm46
Name: RNA binding motif protein 46
Synonyms: LOC329687, ENSMUSG00000033882
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 633285
Homologene: 17016
Daw1
Name: dynein assembly factor with WDR repeat domains 1
Synonyms: b2b1116Clo, b2b1584Clo, Wdr69, 4930563E19Rik, 4933429D11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71227
Kif21a
Name: kinesin family member 21A
Synonyms: N-5 kinesin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16564
VEGA: 15
Homologene: 56761
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: Thm2, 4921538N17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74052
Homologene: 14728
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Capn8
Name: calpain 8
Synonyms: nCL-2, nCL-2'
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170725
HGNC: HGNC:1485
Homologene: 15643
Tulp4
Name: TUB like protein 4
Synonyms: 2210038L17Rik, 1110057P05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68842
Homologene: 32467
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: alphaA-CRYBP1, Cryabp1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Or4k77
Name: olfactory receptor family 4 subfamily K member 77
Synonyms: MOR248-19, Olfr1283, GA_x6K02T2Q125-72420217-72421134
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228443
Homologene: 133657
Supv3l1
Name: suppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms: 6330443E10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 338359
Homologene: 2386
Atp13a4
Name: ATPase type 13A4
Synonyms: 4631413J11Rik, 9330174J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224079
Homologene: 75330
Plch2
Name: phospholipase C, eta 2
Synonyms: A930027K05Rik, PLCeta2, Plcl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269615
Homologene: 85172
Ccdc170
Name: coiled-coil domain containing 170
Synonyms: Gm221, LOC237250
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100504234
Homologene: 69393
Pramel22
Name: PRAME like 22
Synonyms: Gm13088
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277668
Homologene: 129883
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16798
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
Krt17
Name: keratin 17
Synonyms: K17, Krt1-17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16667
HGNC: HGNC:6427
Homologene: 363
Zfp85
Name: zinc finger protein 85
Synonyms: KRAB19, Zfp71, Zfp85-rs1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22746
Homologene: 133709
Adam29
Name: a disintegrin and metallopeptidase domain 29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244486
HGNC: HGNC:207
Homologene: 8607
Gal3st1
Name: galactose-3-O-sulfotransferase 1
Synonyms: GalCer sulfotransferase, Gcst, galactosylceramide sulfotransferase, Cst, 3'-phosphoadenylylsulfate-galactosylceramide 3'-sulfotransferase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53897
Homologene: 3574
Zfp598
Name: zinc finger protein 598
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213753
VEGA: 17
Homologene: 5672
Sfxn4
Name: sideroflexin 4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 94281
Homologene: 14228
Cyp3a11
Name: cytochrome P450, family 3, subfamily a, polypeptide 11
Synonyms: Pcn, Cyp3a, IIIAm1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13112
HGNC: HGNC:2638
Homologene: 133568
Wdr35
Name: WD repeat domain 35
Synonyms: 4930459M12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74682
Homologene: 10814
Klhl36
Name: kelch-like 36
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234796
Homologene: 32598
Mtmr6
Name: myotubularin related protein 6
Synonyms: Gm38641, 4022440C11Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219135
VEGA: 14
HGNC: HGNC:7453
Homologene: 55842
Or5ac17
Name: olfactory receptor family 5 subfamily AC member 17
Synonyms: Olfr199, GA_x54KRFPKG5P-55430495-55429569, MOR182-14
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 404310
Homologene: 37011
Lrrc58
Name: leucine rich repeat containing 58
Synonyms: 1810012N18Rik, C330018J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320184
Homologene: 14598
G6pc1
Name: glucose-6-phosphatase catalytic subunit 1
Synonyms: G6pt, G6pc, Glc-6-Pase, G6Pase, Glc-6-Pase-alpha
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14377
HGNC: HGNC:4056
Homologene: 20079
Trem3
Name: triggering receptor expressed on myeloid cells 3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58218
VEGA: 17
Homologene: 87012
Kcnk13
Name: potassium channel, subfamily K, member 13
Synonyms: THIK-1, LOC381712, F730021E22Rik, LOC380778
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217826
HGNC: HGNC:6275
Homologene: 69351
Ighv1-23
Name: immunoglobulin heavy variable V1-23
Synonyms: immunoglobulin heavy variable V1-23, Ighv1-23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780884
HGNC: HGNC:5553
Ovol3
Name: ovo like zinc finger 3
Synonyms: LOC381867, movo3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381867
Homologene: 35553
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 74,585,520 bp
  • T to A, chromosome 1 at 83,192,715 bp
  • T to C, chromosome 1 at 86,745,500 bp
  • T to A, chromosome 1 at 182,598,675 bp
  • T to A, chromosome 1 at 192,846,710 bp
  • A to T, chromosome 2 at 61,804,817 bp
  • C to T, chromosome 2 at 66,547,187 bp
  • T to A, chromosome 2 at 111,369,362 bp
  • T to A, chromosome 2 at 166,068,529 bp
  • C to T, chromosome 3 at 82,842,488 bp
  • T to A, chromosome 3 at 103,346,640 bp
  • T to C, chromosome 4 at 104,861,429 bp
  • T to A, chromosome 4 at 113,238,228 bp
  • T to C, chromosome 4 at 143,655,560 bp
  • G to A, chromosome 4 at 155,000,460 bp
  • G to T, chromosome 5 at 30,666,948 bp
  • A to T, chromosome 5 at 62,749,475 bp
  • T to A, chromosome 5 at 65,652,535 bp
  • T to A, chromosome 5 at 75,639,000 bp
  • C to A, chromosome 5 at 114,415,284 bp
  • A to C, chromosome 5 at 114,418,626 bp
  • T to C, chromosome 5 at 135,982,705 bp
  • T to G, chromosome 5 at 137,425,562 bp
  • A to T, chromosome 5 at 145,865,900 bp
  • A to G, chromosome 5 at 149,619,020 bp
  • A to T, chromosome 6 at 5,115,378 bp
  • A to T, chromosome 6 at 5,289,080 bp
  • TGGCCCAGGCCCAGGC to TGGCCCAGGCCCAGGCCCAGGC, chromosome 6 at 83,368,229 bp
  • T to A, chromosome 6 at 113,115,082 bp
  • G to A, chromosome 6 at 115,559,982 bp
  • C to T, chromosome 6 at 115,926,302 bp
  • A to G, chromosome 6 at 148,933,102 bp
  • C to T, chromosome 7 at 30,235,221 bp
  • T to A, chromosome 7 at 56,103,718 bp
  • T to A, chromosome 7 at 105,754,948 bp
  • A to G, chromosome 7 at 118,195,893 bp
  • C to A, chromosome 7 at 122,117,331 bp
  • A to G, chromosome 8 at 55,871,574 bp
  • G to T, chromosome 8 at 72,707,830 bp
  • G to T, chromosome 8 at 111,918,408 bp
  • G to A, chromosome 8 at 119,748,197 bp
  • G to A, chromosome 8 at 119,870,175 bp
  • A to G, chromosome 9 at 15,988,482 bp
  • A to G, chromosome 9 at 66,394,756 bp
  • G to T, chromosome 9 at 70,573,466 bp
  • T to A, chromosome 9 at 119,945,539 bp
  • C to T, chromosome 10 at 4,558,512 bp
  • C to T, chromosome 10 at 7,712,942 bp
  • C to T, chromosome 10 at 62,430,470 bp
  • T to A, chromosome 10 at 80,069,575 bp
  • C to A, chromosome 11 at 3,998,227 bp
  • A to G, chromosome 11 at 69,104,735 bp
  • A to G, chromosome 11 at 70,683,888 bp
  • A to G, chromosome 11 at 86,725,228 bp
  • A to G, chromosome 11 at 100,258,465 bp
  • A to C, chromosome 11 at 101,294,226 bp
  • G to T, chromosome 11 at 101,376,677 bp
  • T to C, chromosome 11 at 104,643,577 bp
  • C to T, chromosome 11 at 107,662,030 bp
  • C to T, chromosome 12 at 3,427,108 bp
  • T to A, chromosome 12 at 9,022,785 bp
  • A to G, chromosome 12 at 76,015,563 bp
  • A to T, chromosome 12 at 87,241,931 bp
  • C to A, chromosome 12 at 100,061,726 bp
  • T to C, chromosome 12 at 114,764,475 bp
  • A to G, chromosome 13 at 12,478,457 bp
  • C to T, chromosome 13 at 42,154,911 bp
  • T to C, chromosome 13 at 67,748,945 bp
  • C to T, chromosome 14 at 60,300,304 bp
  • G to A, chromosome 14 at 74,757,037 bp
  • T to C, chromosome 14 at 118,616,446 bp
  • A to T, chromosome 15 at 28,346,952 bp
  • A to G, chromosome 15 at 76,004,426 bp
  • G to T, chromosome 15 at 78,525,374 bp
  • G to A, chromosome 15 at 82,115,481 bp
  • A to G, chromosome 15 at 90,993,796 bp
  • A to T, chromosome 15 at 98,673,901 bp
  • C to T, chromosome 16 at 29,441,196 bp
  • C to A, chromosome 16 at 37,868,691 bp
  • A to T, chromosome 16 at 59,216,398 bp
  • A to T, chromosome 17 at 6,198,708 bp
  • T to C, chromosome 17 at 24,677,530 bp
  • A to G, chromosome 17 at 25,249,108 bp
  • A to G, chromosome 17 at 48,258,470 bp
  • A to G, chromosome 17 at 64,133,521 bp
  • G to A, chromosome 18 at 20,466,628 bp
  • A to T, chromosome 19 at 42,189,520 bp
  • T to A, chromosome 19 at 60,857,361 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7438 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045514-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.