Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7441Btlr/Mmmh
Stock Number:
045517-MU
Citation ID:
RRID:MMRRC_045517-MU
Other Names:
R7441 (G1)
Major Collection:

Strain Information

Esr2
Name: estrogen receptor 2 (beta)
Synonyms: oestrogen receptor beta, ER beta, ERbeta, Estrb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13983
HGNC: HGNC:3468
Homologene: 1100
Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Swt1
Name: SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms: 1200016B10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66875
Homologene: 32355
Asap1
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1
Synonyms: Ddef1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13196
HGNC: HGNC:2720
Homologene: 7684
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Eif2ak4
Name: eukaryotic translation initiation factor 2 alpha kinase 4
Synonyms: GCN2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27103
Homologene: 40891
Iqgap2
Name: IQ motif containing GTPase activating protein 2
Synonyms: 4933417J23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544963
VEGA: 13
HGNC: HGNC:6111
Homologene: 101543
Kcnk1
Name: potassium channel, subfamily K, member 1
Synonyms: TWIK-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16525
HGNC: HGNC:6272
Homologene: 1691
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Cyfip2
Name: cytoplasmic FMR1 interacting protein 2
Synonyms: Pir121, 6430511D02Rik, 1500004I01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76884
Homologene: 7936
Gtf3c3
Name: general transcription factor IIIC, polypeptide 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98488
HGNC: HGNC:4666
Homologene: 40805
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Dsp
Name: desmoplakin
Synonyms: DP, 2300002E22Rik, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: RAB6IP2B, RAB6IP2A, 5033405M01Rik, B430107L16Rik, 9630025C19Rik, Rab6ip2, Elks1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Mybbp1a
Name: MYB binding protein (P160) 1a
Synonyms: p67MBP, p160MBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18432
HGNC: HGNC:7546
Homologene: 40954
Upf2
Name: UPF2 regulator of nonsense transcripts homolog (yeast)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 326622
Homologene: 6101
Dram2
Name: DNA-damage regulated autophagy modulator 2
Synonyms: 2010305N14Rik, 2610318G18Rik, Tmem77
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67171
Homologene: 23565
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Arhgef2
Name: Rho/Rac guanine nucleotide exchange factor 2
Synonyms: Lfc, GEF-H1, LFP40, GEFH1, P40, Lbcl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16800
HGNC: HGNC:682
Homologene: 3468
Dnajc16
Name: DnaJ heat shock protein family (Hsp40) member C16
Synonyms: 2900037O03Rik, 4732437J24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214063
Homologene: 45414
Anpep
Name: alanyl aminopeptidase, membrane
Synonyms: Cd13, aminopeptidase N, Apn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16790
HGNC: HGNC:500
Homologene: 68163
Steap3
Name: STEAP family member 3
Synonyms: pHyde, 1010001D01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68428
Homologene: 10084
Rundc3a
Name: RUN domain containing 3A
Synonyms: Rpip8, Rap2ip
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 51799
Homologene: 4871
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Fam135b
Name: family with sequence similarity 135, member B
Synonyms: A830008O07Rik, 1700010C24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70363
VEGA: 15
Homologene: 66605
Or11g26
Name: olfactory receptor family 11 subfamily G member 26
Synonyms: GA_x6K02T2PMLR-6224293-6225228, MOR106-6, Olfr742
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258422
Homologene: 74163
Vmn2r84
Name: vomeronasal 2, receptor 84
Synonyms: EG625068
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625068
Homologene: 129606
Evpl
Name: envoplakin
Synonyms: 210kDa protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14027
HGNC: HGNC:3503
Homologene: 1506
Krt81
Name: keratin 81
Synonyms: Krt2-19
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64818
VEGA: 15
HGNC: HGNC:6458
Homologene: 55645
Taar7f
Name: trace amine-associated receptor 7F
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 435207
Homologene: 134040
B3galnt2
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 2
Synonyms: A930105D20Rik, D230016N13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97884
VEGA: 13
Homologene: 17595
Spata20
Name: spermatogenesis associated 20
Synonyms: Tisp78
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217116
Homologene: 11264
Zfp426
Name: zinc finger protein 426
Synonyms: KRAB1, Zfp68-rs1, Zfo61, 2900057C04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235028
Homologene: 23435
Gcc2
Name: GRIP and coiled-coil domain containing 2
Synonyms: 0610043A03Rik, 2210420P05Rik, 2600014C01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70297
Homologene: 45639
Agpat1
Name: 1-acylglycerol-3-phosphate O-acyltransferase 1
Synonyms: 1-AGP, Lpaat-alpha
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 55979
HGNC: HGNC:324
Homologene: 55973
Or8u9
Name: olfactory receptor family 8 subfamily U member 9
Synonyms: GA_x6K02T2Q125-47640742-47639798, MOR185-4, Olfr1044
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259013
Homologene: 100542
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Scn11a
Name: sodium channel, voltage-gated, type XI, alpha
Synonyms: SNS2, NaN, NaT, NSS2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24046
VEGA: 9
Homologene: 8041
Timd5
Name: T cell immunoglobulin and mucin domain containing 5
Synonyms: Gm12169
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 210535
Homologene: 130033
4921509C19Rik
Name: RIKEN cDNA 4921509C19 gene
Synonyms: LOC381389
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381393
Homologene: 72396
Zfp937
Name: zinc finger protein 937
Synonyms: Gm4979
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245174
Homologene: 136215
Niban3
Name: niban apoptosis regulator 3
Synonyms: Bcnp1, Fam129c
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100037278
Homologene: 45462
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70859
Homologene: 52823
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Ptpn9
Name: protein tyrosine phosphatase, non-receptor type 9
Synonyms: Meg2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56294
VEGA: 9
HGNC: HGNC:9661
Homologene: 2121
Slc26a9
Name: solute carrier family 26, member 9
Synonyms: anion transporter/exchanger-9, E030002L01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320718
Homologene: 14179
Efhb
Name: EF hand domain family, member B
Synonyms: 4921525D22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211482
VEGA: 17
Homologene: 16982
Aspg
Name: asparaginase
Synonyms: A530050D06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104816
VEGA: 12
Homologene: 113390
Ptpn18
Name: protein tyrosine phosphatase, non-receptor type 18
Synonyms: HSCF, FLP1, Ptpk1, PTP-K1, PTP-HSCF
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19253
HGNC: HGNC:9649
Homologene: 74971
Zfp810
Name: zinc finger protein 810
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235050
VEGA: 9
Homologene: 138299
Gm8267
Name: predicted gene 8267
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666744
Homologene: 115686
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,473,335 bp
  • G to A, chromosome 1 at 54,420,448 bp
  • A to C, chromosome 1 at 120,241,518 bp
  • A to G, chromosome 1 at 131,762,818 bp
  • A to T, chromosome 1 at 151,411,064 bp
  • A to T, chromosome 2 at 6,018,932 bp
  • A to T, chromosome 2 at 20,744,189 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • T to A, chromosome 2 at 86,171,010 bp
  • T to C, chromosome 2 at 90,449,819 bp
  • A to T, chromosome 2 at 113,441,611 bp
  • A to G, chromosome 2 at 118,471,896 bp
  • GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT to G, chromosome 2 at 150,238,710 bp
  • A to C, chromosome 2 at 151,472,925 bp
  • A to G, chromosome 3 at 88,643,955 bp
  • T to C, chromosome 3 at 106,555,187 bp
  • A to T, chromosome 4 at 141,763,813 bp
  • A to G, chromosome 4 at 143,418,840 bp
  • A to G, chromosome 5 at 81,724,140 bp
  • G to A, chromosome 6 at 119,824,951 bp
  • T to G, chromosome 6 at 131,490,391 bp
  • A to G, chromosome 7 at 79,827,644 bp
  • C to T, chromosome 8 at 13,223,069 bp
  • A to G, chromosome 8 at 71,600,164 bp
  • T to C, chromosome 8 at 95,137,987 bp
  • G to T, chromosome 8 at 125,995,568 bp
  • T to C, chromosome 9 at 20,470,851 bp
  • C to A, chromosome 9 at 22,279,272 bp
  • T to A, chromosome 9 at 57,027,433 bp
  • C to T, chromosome 9 at 119,758,626 bp
  • A to G, chromosome 10 at 24,049,987 bp
  • A to G, chromosome 10 at 58,256,901 bp
  • T to C, chromosome 10 at 130,392,113 bp
  • A to T, chromosome 11 at 46,196,427 bp
  • G to A, chromosome 11 at 46,528,555 bp
  • T to A, chromosome 11 at 72,451,275 bp
  • G to A, chromosome 11 at 94,484,041 bp
  • G to T, chromosome 11 at 102,400,046 bp
  • T to A, chromosome 11 at 116,222,956 bp
  • T to C, chromosome 11 at 120,286,306 bp
  • C to A, chromosome 12 at 76,141,394 bp
  • T to G, chromosome 12 at 110,636,453 bp
  • T to C, chromosome 12 at 112,124,821 bp
  • G to A, chromosome 13 at 13,994,485 bp
  • A to G, chromosome 13 at 38,195,449 bp
  • C to A, chromosome 13 at 95,628,076 bp
  • T to A, chromosome 14 at 44,722,940 bp
  • A to T, chromosome 14 at 50,515,396 bp
  • A to G, chromosome 14 at 75,126,257 bp
  • A to G, chromosome 15 at 64,130,256 bp
  • A to T, chromosome 15 at 71,463,680 bp
  • T to C, chromosome 15 at 94,353,673 bp
  • A to G, chromosome 15 at 99,280,089 bp
  • C to A, chromosome 15 at 101,461,370 bp
  • T to A, chromosome 17 at 34,610,909 bp
  • A to T, chromosome 17 at 53,401,521 bp
  • T to A, chromosome 18 at 34,312,073 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7441 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045517-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.