Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7441Btlr/Mmmh
Stock Number:
045517-MU
Citation ID:
RRID:MMRRC_045517-MU
Other Names:
R7441 (G1)
Major Collection:

Strain Information

Esr2
Name: estrogen receptor 2 (beta)
Synonyms: oestrogen receptor beta, ER beta, ERbeta, Estrb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13983
HGNC: HGNC:3468
Homologene: 1100
Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Swt1
Name: SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms: 1200016B10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66875
Homologene: 32355
Asap1
Name: ArfGAP with SH3 domain, ankyrin repeat and PH domain1
Synonyms: Ddef1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13196
HGNC: HGNC:2720
Homologene: 7684
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,473,335 bp
  • G to A, chromosome 1 at 54,420,448 bp
  • A to C, chromosome 1 at 120,241,518 bp
  • A to G, chromosome 1 at 131,762,818 bp
  • A to T, chromosome 1 at 151,411,064 bp
  • A to T, chromosome 2 at 6,018,932 bp
  • A to T, chromosome 2 at 20,744,189 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • T to A, chromosome 2 at 86,171,010 bp
  • T to C, chromosome 2 at 90,449,819 bp
  • A to T, chromosome 2 at 113,441,611 bp
  • A to G, chromosome 2 at 118,471,896 bp
  • GTGATAAGGCATTTGCACAAAACAGTCATCTCCTAACACATAAAAGAACACAT to G, chromosome 2 at 150,238,710 bp
  • A to C, chromosome 2 at 151,472,925 bp
  • A to G, chromosome 3 at 88,643,955 bp
  • T to C, chromosome 3 at 106,555,187 bp
  • A to T, chromosome 4 at 141,763,813 bp
  • A to G, chromosome 4 at 143,418,840 bp
  • A to G, chromosome 5 at 81,724,140 bp
  • G to A, chromosome 6 at 119,824,951 bp
  • T to G, chromosome 6 at 131,490,391 bp
  • A to G, chromosome 7 at 79,827,644 bp
  • C to T, chromosome 8 at 13,223,069 bp
  • A to G, chromosome 8 at 71,600,164 bp
  • T to C, chromosome 8 at 95,137,987 bp
  • G to T, chromosome 8 at 125,995,568 bp
  • T to C, chromosome 9 at 20,470,851 bp
  • C to A, chromosome 9 at 22,279,272 bp
  • T to A, chromosome 9 at 57,027,433 bp
  • C to T, chromosome 9 at 119,758,626 bp
  • A to G, chromosome 10 at 24,049,987 bp
  • A to G, chromosome 10 at 58,256,901 bp
  • T to C, chromosome 10 at 130,392,113 bp
  • A to T, chromosome 11 at 46,196,427 bp
  • G to A, chromosome 11 at 46,528,555 bp
  • T to A, chromosome 11 at 72,451,275 bp
  • G to A, chromosome 11 at 94,484,041 bp
  • G to T, chromosome 11 at 102,400,046 bp
  • T to A, chromosome 11 at 116,222,956 bp
  • T to C, chromosome 11 at 120,286,306 bp
  • C to A, chromosome 12 at 76,141,394 bp
  • T to G, chromosome 12 at 110,636,453 bp
  • T to C, chromosome 12 at 112,124,821 bp
  • G to A, chromosome 13 at 13,994,485 bp
  • A to G, chromosome 13 at 38,195,449 bp
  • C to A, chromosome 13 at 95,628,076 bp
  • T to A, chromosome 14 at 44,722,940 bp
  • A to T, chromosome 14 at 50,515,396 bp
  • A to G, chromosome 14 at 75,126,257 bp
  • A to G, chromosome 15 at 64,130,256 bp
  • A to T, chromosome 15 at 71,463,680 bp
  • T to C, chromosome 15 at 94,353,673 bp
  • A to G, chromosome 15 at 99,280,089 bp
  • C to A, chromosome 15 at 101,461,370 bp
  • T to A, chromosome 17 at 34,610,909 bp
  • A to T, chromosome 17 at 53,401,521 bp
  • T to A, chromosome 18 at 34,312,073 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7441 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045517-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.