Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7449Btlr/Mmmh
Stock Number:
045524-MU
Citation ID:
RRID:MMRRC_045524-MU
Other Names:
R7449 (G1)
Major Collection:

Strain Information

Tgfb1
Name: transforming growth factor, beta 1
Synonyms: TGF-beta 1, Tgfb-1, Tgfb, TGFbeta1, TGF-beta1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21803
Homologene: 540
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Lrrn3
Name: leucine rich repeat protein 3, neuronal
Synonyms: NLRR-3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16981
VEGA: 12
Homologene: 36315
Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, D14Ggc1e, Mmot1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Gdf6
Name: growth differentiation factor 6
Synonyms: BMP13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242316
HGNC: HGNC:4221
Homologene: 40883
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 128,244,543 bp
  • T to C, chromosome 2 at 62,303,946 bp
  • T to C, chromosome 2 at 117,287,943 bp
  • T to C, chromosome 2 at 164,502,499 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • C to A, chromosome 3 at 96,047,136 bp
  • T to A, chromosome 4 at 9,844,494 bp
  • T to A, chromosome 4 at 101,102,663 bp
  • A to G, chromosome 5 at 72,605,304 bp
  • C to G, chromosome 5 at 93,273,343 bp
  • A to G, chromosome 5 at 100,037,155 bp
  • A to G, chromosome 5 at 110,774,586 bp
  • A to G, chromosome 5 at 144,851,209 bp
  • T to A, chromosome 6 at 48,752,904 bp
  • T to C, chromosome 6 at 84,137,380 bp
  • T to C, chromosome 6 at 107,568,521 bp
  • T to C, chromosome 6 at 108,389,384 bp
  • C to T, chromosome 6 at 118,602,349 bp
  • T to C, chromosome 7 at 10,904,058 bp
  • T to G, chromosome 7 at 23,417,526 bp
  • G to A, chromosome 7 at 25,704,838 bp
  • A to T, chromosome 7 at 64,208,975 bp
  • A to G, chromosome 7 at 86,465,855 bp
  • G to A, chromosome 7 at 86,731,748 bp
  • A to T, chromosome 7 at 96,874,213 bp
  • G to T, chromosome 7 at 103,767,819 bp
  • A to C, chromosome 7 at 117,592,005 bp
  • T to A, chromosome 7 at 120,435,908 bp
  • T to C, chromosome 8 at 3,507,285 bp
  • T to A, chromosome 8 at 22,011,849 bp
  • A to T, chromosome 8 at 85,079,681 bp
  • T to C, chromosome 8 at 120,229,711 bp
  • T to A, chromosome 9 at 19,566,866 bp
  • T to C, chromosome 9 at 107,684,036 bp
  • C to A, chromosome 10 at 44,004,519 bp
  • T to C, chromosome 10 at 53,698,634 bp
  • A to T, chromosome 10 at 76,580,163 bp
  • T to A, chromosome 10 at 82,885,233 bp
  • A to G, chromosome 10 at 107,803,663 bp
  • T to C, chromosome 11 at 3,426,578 bp
  • T to A, chromosome 11 at 98,695,551 bp
  • C to A, chromosome 11 at 99,518,061 bp
  • T to C, chromosome 12 at 24,504,993 bp
  • T to A, chromosome 12 at 41,453,488 bp
  • A to G, chromosome 12 at 76,566,222 bp
  • T to C, chromosome 12 at 79,079,552 bp
  • A to C, chromosome 12 at 109,026,441 bp
  • A to T, chromosome 12 at 112,634,151 bp
  • T to A, chromosome 13 at 8,943,304 bp
  • T to G, chromosome 13 at 13,482,051 bp
  • C to T, chromosome 13 at 75,910,741 bp
  • A to G, chromosome 13 at 77,759,442 bp
  • A to T, chromosome 13 at 81,499,073 bp
  • C to T, chromosome 13 at 99,508,140 bp
  • C to A, chromosome 14 at 37,131,581 bp
  • T to C, chromosome 14 at 55,767,918 bp
  • T to A, chromosome 14 at 67,410,020 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • G to A, chromosome 15 at 73,146,499 bp
  • T to C, chromosome 15 at 76,705,565 bp
  • T to A, chromosome 16 at 43,881,032 bp
  • C to T, chromosome 16 at 84,831,363 bp
  • T to C, chromosome 16 at 90,876,193 bp
  • G to A, chromosome 17 at 19,379,145 bp
  • A to G, chromosome 17 at 23,459,895 bp
  • C to T, chromosome 17 at 27,435,371 bp
  • C to T, chromosome 17 at 32,157,966 bp
  • C to T, chromosome 17 at 34,703,361 bp
  • A to G, chromosome 17 at 36,964,383 bp
  • C to T, chromosome 17 at 46,964,788 bp
  • T to A, chromosome 17 at 74,702,341 bp
  • T to A, chromosome 19 at 5,553,597 bp
  • T to A, chromosome 19 at 47,267,652 bp
  • G to A, chromosome X at 37,518,992 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7449 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045524-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.