Strain Name:
C57BL/6J-MtgxR7454Btlr/Mmmh
Stock Number:
045528-MU
Citation ID:
RRID:MMRRC_045528-MU
Other Names:
R7454 (G1)
Major Collection:

Strain Information

Dspp
Name: dentin sialophosphoprotein
Synonyms: Dsp, Dpp, Dmp3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Ctnnal1
Name: catenin alpha like 1
Synonyms: ACRP, Catnal1, catenin (cadherin associated protein), alpha-like 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54366
HGNC: HGNC:2512
Homologene: 2815
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
2510002D24Rik
Name: RIKEN cDNA 2510002D24 gene
Synonyms: Pants
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72307
Homologene: 72515
Fkbp5
Name: FK506 binding protein 5
Synonyms: D17Ertd592e, Dit1, FKBP51
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14229
HGNC: HGNC:3721
Homologene: 3038
S1pr2
Name: sphingosine-1-phosphate receptor 2
Synonyms: 1100001A16Rik, Edg5, H218, LPb2, S1P2, Gpcr13
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14739
VEGA: 9
HGNC: HGNC:3169
Homologene: 3118
Kdm4b
Name: lysine (K)-specific demethylase 4B
Synonyms: 4732474L06Rik, Jmjd2b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193796
Homologene: 27773
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: Listerin, Zfp294, 4930528H02Rik, Rnf160
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Fnbp4
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 55935
Homologene: 9087
Ralgapb
Name: Ral GTPase activating protein, beta subunit (non-catalytic)
Synonyms: B230339M05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228850
Homologene: 10666
Nme7
Name: NME/NM23 family member 7
Synonyms: non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase), nucleoside-diphosphate kinase, Nm23-M7, D530024H21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171567
Homologene: 8344
Tpp2
Name: tripeptidyl peptidase II
Synonyms: TppII
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22019
Homologene: 2471
Patz1
Name: POZ (BTB) and AT hook containing zinc finger 1
Synonyms: POZ-AT hook-zinc finger protein, MAZR, Zfp278, 8430401L15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56218
Homologene: 8636
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Sap130
Name: Sin3A associated protein
Synonyms: 2610304F09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269003
VEGA: 18
Homologene: 11577
Smc4
Name: structural maintenance of chromosomes 4
Synonyms: 2500002A22Rik, Smc4l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70099
Homologene: 4015
Mark3
Name: MAP/microtubule affinity regulating kinase 3
Synonyms: 1600015G02Rik, A430080F22Rik, ETK-1, C-TAK1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17169
VEGA: 12
HGNC: HGNC:6897
Homologene: 55653
Krit1
Name: KRIT1, ankyrin repeat containing
Synonyms: Ccm1, Krit1A, A630036P20Rik, Krit1B, Krit1, 2010007K12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 79264
HGNC: HGNC:1573
Homologene: 12746
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: Dnahc7, LOC381341, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Noct
Name: nocturnin
Synonyms: Ccr4, Ccrn4l
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12457
Homologene: 7661
Lmo1
Name: LIM domain only 1
Synonyms: Rbtn-1, Ttg1, Rbtn1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 109594
HGNC: HGNC:6641
Homologene: 48101
Erc2
Name: ELKS/RAB6-interacting/CAST family member 2
Synonyms: CAST, D14Ertd171e, ELKS2alpha
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 238988
Homologene: 69188
Poc5
Name: POC5 centriolar protein
Synonyms: 1200014M14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67463
VEGA: 13
Homologene: 12141
Gga2
Name: golgi associated, gamma adaptin ear containing, ARF binding protein 2
Synonyms: 1200007E24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74105
Homologene: 22860
Bicra
Name: BRD4 interacting chromatin remodeling complex associated protein
Synonyms: Gltscr1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243842
HGNC: HGNC:4332
Homologene: 9250
Kat6a
Name: K(lysine) acetyltransferase 6A
Synonyms: 9930021N24Rik, Zfp220, MOZ, Myst3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244349
Homologene: 4924
Fzd2
Name: frizzled class receptor 2
Synonyms: Mfz10a, Mfz10, Fz10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57265
HGNC: HGNC:4040
Homologene: 20377
Clec4a2
Name: C-type lectin domain family 4, member a2
Synonyms: Clecsf6, Dcir1, DCIR, dendritic cell immunoreceptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26888
Homologene: 49291
Lig1
Name: ligase I, DNA, ATP-dependent
Synonyms: mLigI, LigI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16881
HGNC: HGNC:6598
Homologene: 197
Tarbp1
Name: TAR RNA binding protein 1
Synonyms: Gm17296
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212728
Homologene: 38082
Ttn
Name: titin
Synonyms: 2310036G12Rik, 2310057K23Rik, D330041I19Rik, mdm, connectin, D830007G01Rik, 1100001C23Rik, shru, 2310074I15Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: EG545370, LOC240793
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: Dnahc6, A730004I20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Adtrp
Name: androgen dependent TFPI regulating protein
Synonyms: 9530008L14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109254
Homologene: 13107
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Hmgb4
Name: high-mobility group box 4
Synonyms: 1700001F22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69317
Homologene: 83321
Celf5
Name: CUGBP, Elav-like family member 5
Synonyms: Brunol5, 4930565A21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319586
Homologene: 75172
Jakmip1
Name: janus kinase and microtubule interacting protein 1
Synonyms: Marlin-1, Gababrbp, C330021K24Rik, 5830437M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76071
Homologene: 90789
Ppfia4
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4
Synonyms: LOC100042382, Liprin-alpha4, Gm3812, 1110008G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68507
HGNC: HGNC:9248
Homologene: 66200
Bcl11b
Name: B cell leukemia/lymphoma 11B
Synonyms: CTIP2, B630002E05Rik, 9130430L19Rik, COUP-TF interacting protein 2, Rit1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 58208
Homologene: 10974
Itgal
Name: integrin alpha L
Synonyms: Ly-21, LFA-1, Cd11a, Ly-15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16408
HGNC: HGNC:6148
Homologene: 1666
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 116904
Homologene: 10813
Fam171a2
Name: family with sequence similarity 171, member A2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217219
Homologene: 19144
Pla2g4a
Name: phospholipase A2, group IVA (cytosolic, calcium-dependent)
Synonyms: cytosolic phospholipase A2, Type IV PLA2, cPLA2alpha, cPLA2, cytosolic PLA2, Pla2g4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18783
HGNC: HGNC:9035
Homologene: 32059
Fam149a
Name: family with sequence similarity 149, member A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212326
Homologene: 27540
Rbak
Name: RB-associated KRAB zinc finger
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57782
Homologene: 23287
Per3
Name: period circadian clock 3
Synonyms: mPer3, 2810049O06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18628
HGNC: HGNC:8847
Homologene: 7886
Adamts10
Name: ADAM metallopeptidase with thrombospondin type 1 motif 10
Synonyms: ZnMP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224697
Homologene: 81940
Or5ak22
Name: olfactory receptor family 5 subfamily AK member 22
Synonyms: Olfr992, MOR203-1, GA_x6K02T2Q125-46877170-46876241
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258865
Homologene: 121517
Tgfbr3
Name: transforming growth factor, beta receptor III
Synonyms: betaglycan, 1110036H20Rik, TBRIII
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21814
Homologene: 2436
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Ttc28
Name: tetratricopeptide repeat domain 28
Synonyms: 2310015L07Rik, TPRBK
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 209683
Homologene: 41023
Trbc2
Name: T cell receptor beta, constant 2
Synonyms: BB153276, Tcrb-C2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100125263
Gm1110
Name: predicted gene 1110
Synonyms: LOC382064
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382064
VEGA: 9
Homologene: 78608
Slc46a1
Name: solute carrier family 46, member 1
Synonyms: heme carrier protein 1, D11Ertd18e, 1110002C08Rik, HCP1, PCFT
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52466
Homologene: 41693
Dzip1l
Name: DAZ interacting protein 1-like
Synonyms: 2610524A10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72507
Homologene: 12466
Vmn2r112
Name: vomeronasal 2, receptor 112
Synonyms: EG628185
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 628185
Homologene: 86604
Mrgprg
Name: MAS-related GPR, member G
Synonyms: LOC381974, MrgG
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381974
Homologene: 28580
Cilp2
Name: cartilage intermediate layer protein 2
Synonyms: CLIP-2, 1110031K21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68709
Homologene: 17713
Bbs12
Name: Bardet-Biedl syndrome 12
Synonyms: LOC386537, LOC241950, LOC241950
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241950
Homologene: 17634
4932414N04Rik
Name: RIKEN cDNA 4932414N04 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75721
Homologene: 138468
Gbp2b
Name: guanylate binding protein 2b
Synonyms: LIMIT, Mag-1, Mpa1, Gbp-1, Gbp1, Mpa-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14468
Homologene: 137233
Or11h4b
Name: olfactory receptor family 11 subfamily H member 4B
Synonyms: MOR106-16, Olfr747, GA_x6K02T2PMLR-6420220-6419279, MOR106-7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258264
Homologene: 10652
Dlgap3
Name: DLG associated protein 3
Synonyms: SAP90/PSD 95 associated protein 3, Sapap3, DAP3, Prpl8, PSD-95/SAP90-binding protein 3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242667
Homologene: 18276
Zbtb8b
Name: zinc finger and BTB domain containing 8b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 215627
Homologene: 65127
Mfrp
Name: membrane frizzled-related protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259172
Homologene: 12866
Or8g2
Name: olfactory receptor family 8 subfamily G member 2
Synonyms: GA_x6K02T2PVTD-33608180-33608971, Olfr229, MOR171-14, GA_x6K02T02EEW-227-373, Olfr973
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258606
VEGA: 9
Homologene: 115513
Prss42
Name: serine protease 42
Synonyms: Tessp2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235628
Homologene: 27410
Pnliprp1
Name: pancreatic lipase related protein 1
Synonyms: Plrp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18946
VEGA: 19
HGNC: HGNC:9156
Homologene: 21253
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: Ccdc7, 4930517G15Rik, 4930540C21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
Wdr38
Name: WD repeat domain 38
Synonyms: 1700123D08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76646
Homologene: 79011
Jazf1
Name: JAZF zinc finger 1
Synonyms: Tip27, Jaz1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231986
Homologene: 18291
Ndufaf3
Name: NADH:ubiquinone oxidoreductase complex assembly factor 3
Synonyms: 4733401H18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66706
Homologene: 32460
Btnl4
Name: butyrophilin-like 4
Synonyms: EG632126, Btn3a3, NG11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 632126
Homologene: 106849
Anks6
Name: ankyrin repeat and sterile alpha motif domain containing 6
Synonyms: b2b1801.1Clo, SamCystin, LOC269533, 2210417J20Rik, Samd6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75691
Homologene: 19545
Or13a26
Name: olfactory receptor family 13 subfamily A member 26
Synonyms: GA_x6K02T2PBJ9-42850324-42851256, Olfr541, MOR253-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258964
Homologene: 138322
Or4b1
Name: olfactory receptor family 4 subfamily B member 1
Synonyms: Olfr1270, MOR227-1, GA_x6K02T2Q125-51584440-51583526
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258987
HGNC: HGNC:8290
Homologene: 133648
Ttyh3
Name: tweety family member 3
Synonyms: 2900029G13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78339
Homologene: 18431
Trim3
Name: tripartite motif-containing 3
Synonyms: BERP1, HAC1, Rnf22
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 55992
Homologene: 21290
Galm
Name: galactose mutarotase
Synonyms: A530057M15Rik, aldose 1-epimerase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319625
Homologene: 71795
Gm15922
Name: predicted gene 15922
Type: Gene
Species: Mouse
Chromosome: 7
Krtap6-2
Name: keratin associated protein 6-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16701
Arl4d
Name: ADP-ribosylation factor-like 4D
Synonyms: Arfl4, Arf4l, Arl5, 1110036H21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80981
HGNC: HGNC:656
Homologene: 1255
Lrrc30
Name: leucine rich repeat containing 30
Synonyms: LOC240131
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240131
VEGA: 17
Homologene: 33184
Or6c203
Name: olfactory receptor family 6 subfamily C member 203
Synonyms: GA_x6K02T2PULF-10860457-10859522, Olfr772, MOR114-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 257666
Homologene: 123776
Gm10053
Name: predicted gene 10053
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 672195
VEGA: 19
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,954,659 bp
  • T to A, chromosome 1 at 53,518,764 bp
  • A to G, chromosome 1 at 134,324,135 bp
  • T to C, chromosome 1 at 149,872,690 bp
  • A to G, chromosome 1 at 150,563,604 bp
  • T to A, chromosome 1 at 164,380,648 bp
  • C to T, chromosome 2 at 38,998,340 bp
  • C to A, chromosome 2 at 68,688,304 bp
  • C to T, chromosome 2 at 76,725,818 bp
  • T to A, chromosome 2 at 76,944,139 bp
  • T to A, chromosome 2 at 85,399,611 bp
  • T to A, chromosome 2 at 90,149,419 bp
  • ACCACCTCCACCTCCACCTCC to ACCACCTCCACCTCCACCTCCACCTCC, chromosome 2 at 90,777,815 bp
  • T to A, chromosome 2 at 158,432,902 bp
  • T to C, chromosome 3 at 37,320,953 bp
  • G to T, chromosome 3 at 51,249,730 bp
  • A to T, chromosome 3 at 69,018,124 bp
  • A to G, chromosome 3 at 88,983,865 bp
  • T to A, chromosome 3 at 142,598,159 bp
  • T to C, chromosome 4 at 47,038,919 bp
  • A to T, chromosome 4 at 56,844,544 bp
  • G to T, chromosome 4 at 127,235,059 bp
  • A to G, chromosome 4 at 128,260,406 bp
  • G to A, chromosome 4 at 129,432,769 bp
  • A to G, chromosome 4 at 151,012,728 bp
  • T to C, chromosome 5 at 3,812,474 bp
  • C to A, chromosome 5 at 37,175,154 bp
  • T to A, chromosome 5 at 104,175,610 bp
  • A to T, chromosome 5 at 107,215,028 bp
  • T to C, chromosome 5 at 111,285,484 bp
  • T to C, chromosome 5 at 140,629,425 bp
  • A to C, chromosome 5 at 143,173,773 bp
  • G to T, chromosome 6 at 41,546,829 bp
  • T to C, chromosome 6 at 52,893,944 bp
  • T to A, chromosome 6 at 73,212,492 bp
  • T to C, chromosome 6 at 123,142,452 bp
  • T to G, chromosome 7 at 3,735,510 bp
  • A to T, chromosome 7 at 13,288,721 bp
  • C to G, chromosome 7 at 15,972,134 bp
  • A to C, chromosome 7 at 81,078,562 bp
  • C to T, chromosome 7 at 105,619,558 bp
  • A to T, chromosome 7 at 109,140,666 bp
  • T to C, chromosome 7 at 122,002,146 bp
  • C to A, chromosome 7 at 127,327,764 bp
  • A to T, chromosome 7 at 140,704,634 bp
  • A to G, chromosome 7 at 143,765,135 bp
  • A to G, chromosome 8 at 22,935,772 bp
  • G to T, chromosome 8 at 45,348,546 bp
  • G to A, chromosome 8 at 69,883,390 bp
  • G to A, chromosome 8 at 104,211,026 bp
  • C to A, chromosome 8 at 126,457,677 bp
  • A to G, chromosome 8 at 128,944,516 bp
  • G to T, chromosome 9 at 20,967,549 bp
  • T to C, chromosome 9 at 26,920,649 bp
  • A to G, chromosome 9 at 39,909,904 bp
  • G to T, chromosome 9 at 44,105,183 bp
  • A to C, chromosome 9 at 64,852,570 bp
  • T to A, chromosome 9 at 96,048,358 bp
  • G to A, chromosome 9 at 99,659,674 bp
  • A to T, chromosome 9 at 108,566,926 bp
  • A to G, chromosome 9 at 110,798,829 bp
  • T to C, chromosome 10 at 81,482,523 bp
  • T to A, chromosome 10 at 129,174,455 bp
  • C to T, chromosome 11 at 3,298,297 bp
  • T to A, chromosome 11 at 78,466,511 bp
  • A to G, chromosome 11 at 101,666,660 bp
  • T to C, chromosome 11 at 102,439,717 bp
  • T to C, chromosome 11 at 102,605,129 bp
  • T to C, chromosome 11 at 107,044,640 bp
  • T to C, chromosome 12 at 51,961,543 bp
  • C to A, chromosome 12 at 107,916,208 bp
  • T to C, chromosome 12 at 111,604,527 bp
  • A to G, chromosome 13 at 3,585,332 bp
  • G to A, chromosome 13 at 41,828,315 bp
  • G to T, chromosome 13 at 96,400,832 bp
  • A to G, chromosome 14 at 28,302,991 bp
  • T to A, chromosome 14 at 50,680,824 bp
  • A to G, chromosome 16 at 18,836,851 bp
  • T to C, chromosome 16 at 87,397,812 bp
  • A to T, chromosome 16 at 89,419,912 bp
  • A to T, chromosome 17 at 22,603,307 bp
  • A to C, chromosome 17 at 28,416,025 bp
  • T to A, chromosome 17 at 33,545,005 bp
  • A to T, chromosome 17 at 34,472,374 bp
  • C to A, chromosome 17 at 56,389,639 bp
  • A to T, chromosome 17 at 67,632,243 bp
  • A to G, chromosome 17 at 80,138,121 bp
  • T to C, chromosome 18 at 31,650,512 bp
  • A to G, chromosome 19 at 24,875,900 bp
  • A to G, chromosome 19 at 58,741,100 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7454 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045528-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.