Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7454Btlr/Mmmh
Stock Number:
045528-MU
Citation ID:
RRID:MMRRC_045528-MU
Other Names:
R7454 (G1)
Major Collection:

Strain Information

Dspp
Name: dentin sialophosphoprotein
Synonyms: Dmp3, Dpp, Dsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666279
HGNC: HGNC:3054
Ctnnal1
Name: catenin alpha like 1
Synonyms: ACRP, Catnal1, catenin (cadherin associated protein), alpha-like 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54366
HGNC: HGNC:2512
Homologene: 2815
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
2510002D24Rik
Name: RIKEN cDNA 2510002D24 gene
Synonyms: Pants
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72307
Homologene: 72515
Fkbp5
Name: FK506 binding protein 5
Synonyms: FKBP51, Dit1, D17Ertd592e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14229
HGNC: HGNC:3721
Homologene: 3038
S1pr2
Name: sphingosine-1-phosphate receptor 2
Synonyms: Gpcr13, H218, S1P2, LPb2, 1100001A16Rik, Edg5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14739
VEGA: 9
HGNC: HGNC:3169
Homologene: 3118
Kdm4b
Name: lysine (K)-specific demethylase 4B
Synonyms: 4732474L06Rik, Jmjd2b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193796
Homologene: 27773
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,954,659 bp
  • T to A, chromosome 1 at 53,518,764 bp
  • A to G, chromosome 1 at 134,324,135 bp
  • T to C, chromosome 1 at 149,872,690 bp
  • A to G, chromosome 1 at 150,563,604 bp
  • T to A, chromosome 1 at 164,380,648 bp
  • C to T, chromosome 2 at 38,998,340 bp
  • C to A, chromosome 2 at 68,688,304 bp
  • C to T, chromosome 2 at 76,725,818 bp
  • T to A, chromosome 2 at 76,944,139 bp
  • T to A, chromosome 2 at 85,399,611 bp
  • T to A, chromosome 2 at 90,149,419 bp
  • ACCACCTCCACCTCCACCTCC to ACCACCTCCACCTCCACCTCCACCTCC, chromosome 2 at 90,777,815 bp
  • T to A, chromosome 2 at 158,432,902 bp
  • T to C, chromosome 3 at 37,320,953 bp
  • G to T, chromosome 3 at 51,249,730 bp
  • A to T, chromosome 3 at 69,018,124 bp
  • A to G, chromosome 3 at 88,983,865 bp
  • T to A, chromosome 3 at 142,598,159 bp
  • T to C, chromosome 4 at 47,038,919 bp
  • A to T, chromosome 4 at 56,844,544 bp
  • G to T, chromosome 4 at 127,235,059 bp
  • A to G, chromosome 4 at 128,260,406 bp
  • G to A, chromosome 4 at 129,432,769 bp
  • A to G, chromosome 4 at 151,012,728 bp
  • T to C, chromosome 5 at 3,812,474 bp
  • C to A, chromosome 5 at 37,175,154 bp
  • T to A, chromosome 5 at 104,175,610 bp
  • A to T, chromosome 5 at 107,215,028 bp
  • T to C, chromosome 5 at 111,285,484 bp
  • T to C, chromosome 5 at 140,629,425 bp
  • A to C, chromosome 5 at 143,173,773 bp
  • G to T, chromosome 6 at 41,546,829 bp
  • T to C, chromosome 6 at 52,893,944 bp
  • T to A, chromosome 6 at 73,212,492 bp
  • T to C, chromosome 6 at 123,142,452 bp
  • T to G, chromosome 7 at 3,735,510 bp
  • A to T, chromosome 7 at 13,288,721 bp
  • C to G, chromosome 7 at 15,972,134 bp
  • A to C, chromosome 7 at 81,078,562 bp
  • C to T, chromosome 7 at 105,619,558 bp
  • A to T, chromosome 7 at 109,140,666 bp
  • T to C, chromosome 7 at 122,002,146 bp
  • C to A, chromosome 7 at 127,327,764 bp
  • A to T, chromosome 7 at 140,704,634 bp
  • A to G, chromosome 7 at 143,765,135 bp
  • A to G, chromosome 8 at 22,935,772 bp
  • G to T, chromosome 8 at 45,348,546 bp
  • G to A, chromosome 8 at 69,883,390 bp
  • G to A, chromosome 8 at 104,211,026 bp
  • C to A, chromosome 8 at 126,457,677 bp
  • A to G, chromosome 8 at 128,944,516 bp
  • G to T, chromosome 9 at 20,967,549 bp
  • T to C, chromosome 9 at 26,920,649 bp
  • A to G, chromosome 9 at 39,909,904 bp
  • G to T, chromosome 9 at 44,105,183 bp
  • A to C, chromosome 9 at 64,852,570 bp
  • T to A, chromosome 9 at 96,048,358 bp
  • G to A, chromosome 9 at 99,659,674 bp
  • A to T, chromosome 9 at 108,566,926 bp
  • A to G, chromosome 9 at 110,798,829 bp
  • T to C, chromosome 10 at 81,482,523 bp
  • T to A, chromosome 10 at 129,174,455 bp
  • C to T, chromosome 11 at 3,298,297 bp
  • T to A, chromosome 11 at 78,466,511 bp
  • A to G, chromosome 11 at 101,666,660 bp
  • T to C, chromosome 11 at 102,439,717 bp
  • T to C, chromosome 11 at 102,605,129 bp
  • T to C, chromosome 11 at 107,044,640 bp
  • T to C, chromosome 12 at 51,961,543 bp
  • C to A, chromosome 12 at 107,916,208 bp
  • T to C, chromosome 12 at 111,604,527 bp
  • A to G, chromosome 13 at 3,585,332 bp
  • G to A, chromosome 13 at 41,828,315 bp
  • G to T, chromosome 13 at 96,400,832 bp
  • A to G, chromosome 14 at 28,302,991 bp
  • T to A, chromosome 14 at 50,680,824 bp
  • A to G, chromosome 16 at 18,836,851 bp
  • T to C, chromosome 16 at 87,397,812 bp
  • A to T, chromosome 16 at 89,419,912 bp
  • A to T, chromosome 17 at 22,603,307 bp
  • A to C, chromosome 17 at 28,416,025 bp
  • T to A, chromosome 17 at 33,545,005 bp
  • A to T, chromosome 17 at 34,472,374 bp
  • C to A, chromosome 17 at 56,389,639 bp
  • A to T, chromosome 17 at 67,632,243 bp
  • A to G, chromosome 17 at 80,138,121 bp
  • T to C, chromosome 18 at 31,650,512 bp
  • A to G, chromosome 19 at 24,875,900 bp
  • A to G, chromosome 19 at 58,741,100 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7454 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045528-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.