Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7458Btlr/Mmmh
Stock Number:
045532-MU
Citation ID:
RRID:MMRRC_045532-MU
Other Names:
R7458 (G1)
Major Collection:

Strain Information

Cdh3
Name: cadherin 3
Synonyms: P-cadherin, Cadp, Pcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12560
HGNC: HGNC:1762
Homologene: 20425
Sntb2
Name: syntrophin, basic 2
Synonyms: Snt2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20650
Homologene: 4911
Pnn
Name: pinin
Synonyms: D12Ertd512e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18949
VEGA: 12
HGNC: HGNC:9162
Homologene: 37656
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: 2310079H06Rik, D030051N19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Cct7
Name: chaperonin containing TCP1 subunit 7
Synonyms: Cctz, Ccth
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12468
HGNC: HGNC:1622
Homologene: 4694
Zfp866
Name: zinc finger protein 866
Synonyms: 9830167H18Rik, D330038O06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330788
Psen1
Name: presenilin 1
Synonyms: S182, PS1, PS-1, presenilin-1, Ad3h
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19164
VEGA: 12
HGNC: HGNC:9508
Homologene: 7186
Dnajc10
Name: DnaJ heat shock protein family (Hsp40) member C10
Synonyms: JPDI, 1200006L06Rik, D2Ertd706e, ERdj5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66861
Homologene: 10358
Boc
Name: BOC cell adhesion associated, oncogene regulated
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 117606
Homologene: 32819
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20499
VEGA: 13
Homologene: 21312
2900026A02Rik
Name: RIKEN cDNA 2900026A02 gene
Synonyms: LOC231620, Gm449
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243219
Homologene: 129566
Akr1a1
Name: aldo-keto reductase family 1, member A1
Synonyms: 2610201A18Rik, Akr1a4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 58810
HGNC: HGNC:380
Homologene: 74565
Gak
Name: cyclin G associated kinase
Synonyms: D130045N16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231580
HGNC: HGNC:4113
Homologene: 3846
G2e3
Name: G2/M-phase specific E3 ubiquitin ligase
Synonyms: D930034K21Rik, 6030408C04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217558
Homologene: 32362
Txndc12
Name: thioredoxin domain containing 12 (endoplasmic reticulum)
Synonyms: 0610040B21Rik, ERp16
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66073
Homologene: 41074
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Armh4
Name: armadillo-like helical domain containing 4
Synonyms: 3632451O06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67419
Homologene: 12127
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Wdpcp
Name: WD repeat containing planar cell polarity effector
Synonyms: homoloc-13, AV249152
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216560
Homologene: 9299
AI182371
Name: expressed sequence AI182371
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98870
HGNC: HGNC:1331
Homologene: 87268
Pls1
Name: plastin 1 (I-isoform)
Synonyms: I-fimbrin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102502
HGNC: HGNC:9090
Homologene: 68270
Tas2r135
Name: taste receptor, type 2, member 135
Synonyms: mt2r38, Tas2r35
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387512
Homologene: 52230
Irs2
Name: insulin receptor substrate 2
Synonyms: Irs-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384783
HGNC: HGNC:6126
Homologene: 2778
Lipn
Name: lipase, family member N
Synonyms: 2210418G03Rik, Lipl4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70166
Homologene: 66969
Itih1
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: inter-alpha (globulin) inhibitor, H1 polypeptide, Intin1, Itih-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16424
HGNC: HGNC:6166
Homologene: 1667
Necab1
Name: N-terminal EF-hand calcium binding protein 1
Synonyms: STIP-1, NECAB1, 1700003H21Rik, Efcbp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69352
Homologene: 11172
Itga1
Name: integrin alpha 1
Synonyms: CD49A, Vla1, E130012M19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109700
VEGA: 13
HGNC: HGNC:6134
Homologene: 57137
Aldh8a1
Name: aldehyde dehydrogenase 8 family, member A1
Synonyms: RALDH4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237320
Homologene: 23369
Vmn2r108
Name: vomeronasal 2, receptor 108
Synonyms: EG627805
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627805
Homologene: 129678
Vmn2r58
Name: vomeronasal 2, receptor 58
Synonyms: EG628422
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628422
Usp4
Name: ubiquitin specific peptidase 4 (proto-oncogene)
Synonyms: Unp, F730026I20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22258
Homologene: 20716
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, restin, Clip 170
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Phyhip
Name: phytanoyl-CoA hydroxylase interacting protein
Synonyms: PAHX-AP#1, PAHX-AP1, C630010D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105653
Homologene: 8847
Or5m8
Name: olfactory receptor family 5 subfamily M member 8
Synonyms: GA_x6K02T2Q125-47470765-47471775, MOR200-1, Olfr1031
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257916
Homologene: 73973
Lgr5
Name: leucine rich repeat containing G protein coupled receptor 5
Synonyms: Gpr49
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14160
HGNC: HGNC:4504
Homologene: 20807
Slc2a13
Name: solute carrier family 2 (facilitated glucose transporter), member 13
Synonyms: A630029G22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239606
Homologene: 43139
Gm9493
Name: predicted gene 9493
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 102638448
VEGA: 19
Homologene: 137145
Apol7e
Name: apolipoprotein L 7e
Synonyms: ENSMUSG00000071716
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666348
VEGA: 15
Homologene: 40940
Ubash3a
Name: ubiquitin associated and SH3 domain containing, A
Synonyms: 5830413C03Rik, Sts-2, TULA
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328795
Homologene: 56833
Slc25a44
Name: solute carrier family 25, member 44
Synonyms: B430110G05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229517
Homologene: 14000
Gpr65
Name: G-protein coupled receptor 65
Synonyms: TDAG8, Gpcr25, Dig1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14744
VEGA: 12
HGNC: HGNC:4517
Homologene: 2675
Ccne1
Name: cyclin E1
Synonyms: cyclin E, CycE1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12447
HGNC: HGNC:1589
Homologene: 14452
Bricd5
Name: BRICHOS domain containing 5
Synonyms: 9930021D14Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 319259
VEGA: 17
Homologene: 37096
Rhox8
Name: reproductive homeobox 8
Synonyms: Tox
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 434768
Homologene: 90879
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 82,498,948 bp
  • T to A, chromosome 2 at 35,086,504 bp
  • T to A, chromosome 2 at 80,324,750 bp
  • A to G, chromosome 2 at 85,992,650 bp
  • T to A, chromosome 2 at 91,917,684 bp
  • T to A, chromosome 2 at 125,319,116 bp
  • A to G, chromosome 3 at 88,416,061 bp
  • A to T, chromosome 4 at 15,111,244 bp
  • A to G, chromosome 4 at 108,861,409 bp
  • A to T, chromosome 4 at 116,637,817 bp
  • T to C, chromosome 5 at 108,583,074 bp
  • C to T, chromosome 5 at 113,190,644 bp
  • T to G, chromosome 5 at 123,640,546 bp
  • T to A, chromosome 6 at 42,405,947 bp
  • T to C, chromosome 6 at 85,459,996 bp
  • T to C, chromosome 7 at 38,100,671 bp
  • C to A, chromosome 7 at 41,837,699 bp
  • T to C, chromosome 8 at 11,007,739 bp
  • A to T, chromosome 8 at 15,953,738 bp
  • T to A, chromosome 8 at 69,765,552 bp
  • A to G, chromosome 8 at 106,537,147 bp
  • C to A, chromosome 8 at 106,936,298 bp
  • G to A, chromosome 9 at 95,785,507 bp
  • T to C, chromosome 9 at 108,367,856 bp
  • A to G, chromosome 10 at 21,395,593 bp
  • A to G, chromosome 10 at 115,457,755 bp
  • T to C, chromosome 11 at 9,290,777 bp
  • T to C, chromosome 11 at 21,748,919 bp
  • G to A, chromosome 11 at 103,497,432 bp
  • T to A, chromosome 12 at 51,365,507 bp
  • C to A, chromosome 12 at 59,072,414 bp
  • T to A, chromosome 12 at 83,714,766 bp
  • T to G, chromosome 12 at 98,276,065 bp
  • T to A, chromosome 13 at 73,785,069 bp
  • T to C, chromosome 13 at 114,986,266 bp
  • T to C, chromosome 14 at 30,943,266 bp
  • T to C, chromosome 14 at 49,682,739 bp
  • G to A, chromosome 14 at 70,461,820 bp
  • C to T, chromosome 15 at 77,714,404 bp
  • T to A, chromosome 15 at 91,412,187 bp
  • T to C, chromosome 16 at 44,486,756 bp
  • T to C, chromosome 17 at 20,472,270 bp
  • T to C, chromosome 17 at 24,474,502 bp
  • T to C, chromosome 17 at 31,208,165 bp
  • T to C, chromosome 17 at 43,625,046 bp
  • G to A, chromosome 18 at 31,988,551 bp
  • A to G, chromosome 19 at 23,619,913 bp
  • A to G, chromosome 19 at 34,071,842 bp
  • GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT to GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT, chromosome X at 37,878,114 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7458 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045532-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.