Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7458Btlr/Mmmh
Stock Number:
045532-MU
Citation ID:
RRID:MMRRC_045532-MU
Other Names:
R7458 (G1)
Major Collection:

Strain Information

Cdh3
Name: cadherin 3
Synonyms: P-cadherin, Cadp, Pcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12560
HGNC: HGNC:1762
Homologene: 20425
Sntb2
Name: syntrophin, basic 2
Synonyms: Snt2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20650
Homologene: 4911
Pnn
Name: pinin
Synonyms: D12Ertd512e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18949
VEGA: 12
HGNC: HGNC:9162
Homologene: 37656
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: 2310079H06Rik, D030051N19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Cct7
Name: chaperonin containing TCP1 subunit 7
Synonyms: Cctz, Ccth
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12468
HGNC: HGNC:1622
Homologene: 4694
Zfp866
Name: zinc finger protein 866
Synonyms: 9830167H18Rik, D330038O06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330788
Psen1
Name: presenilin 1
Synonyms: S182, PS1, PS-1, presenilin-1, Ad3h
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19164
VEGA: 12
HGNC: HGNC:9508
Homologene: 7186
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 82,498,948 bp
  • T to A, chromosome 2 at 35,086,504 bp
  • T to A, chromosome 2 at 80,324,750 bp
  • A to G, chromosome 2 at 85,992,650 bp
  • T to A, chromosome 2 at 91,917,684 bp
  • T to A, chromosome 2 at 125,319,116 bp
  • A to G, chromosome 3 at 88,416,061 bp
  • A to T, chromosome 4 at 15,111,244 bp
  • A to G, chromosome 4 at 108,861,409 bp
  • A to T, chromosome 4 at 116,637,817 bp
  • T to C, chromosome 5 at 108,583,074 bp
  • C to T, chromosome 5 at 113,190,644 bp
  • T to G, chromosome 5 at 123,640,546 bp
  • T to A, chromosome 6 at 42,405,947 bp
  • T to C, chromosome 6 at 85,459,996 bp
  • T to C, chromosome 7 at 38,100,671 bp
  • C to A, chromosome 7 at 41,837,699 bp
  • T to C, chromosome 8 at 11,007,739 bp
  • A to T, chromosome 8 at 15,953,738 bp
  • T to A, chromosome 8 at 69,765,552 bp
  • A to G, chromosome 8 at 106,537,147 bp
  • C to A, chromosome 8 at 106,936,298 bp
  • G to A, chromosome 9 at 95,785,507 bp
  • T to C, chromosome 9 at 108,367,856 bp
  • A to G, chromosome 10 at 21,395,593 bp
  • A to G, chromosome 10 at 115,457,755 bp
  • T to C, chromosome 11 at 9,290,777 bp
  • T to C, chromosome 11 at 21,748,919 bp
  • G to A, chromosome 11 at 103,497,432 bp
  • T to A, chromosome 12 at 51,365,507 bp
  • C to A, chromosome 12 at 59,072,414 bp
  • T to A, chromosome 12 at 83,714,766 bp
  • T to G, chromosome 12 at 98,276,065 bp
  • T to A, chromosome 13 at 73,785,069 bp
  • T to C, chromosome 13 at 114,986,266 bp
  • T to C, chromosome 14 at 30,943,266 bp
  • T to C, chromosome 14 at 49,682,739 bp
  • G to A, chromosome 14 at 70,461,820 bp
  • C to T, chromosome 15 at 77,714,404 bp
  • T to A, chromosome 15 at 91,412,187 bp
  • T to C, chromosome 16 at 44,486,756 bp
  • T to C, chromosome 17 at 20,472,270 bp
  • T to C, chromosome 17 at 24,474,502 bp
  • T to C, chromosome 17 at 31,208,165 bp
  • T to C, chromosome 17 at 43,625,046 bp
  • G to A, chromosome 18 at 31,988,551 bp
  • A to G, chromosome 19 at 23,619,913 bp
  • A to G, chromosome 19 at 34,071,842 bp
  • GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT to GCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCT, chromosome X at 37,878,114 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7458 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045532-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.