Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7500Btlr/Mmmh
Stock Number:
045573-MU
Citation ID:
RRID:MMRRC_045573-MU
Other Names:
R7500 (G1)
Major Collection:

Strain Information

Edn3
Name: endothelin 3
Synonyms: 114CH19, 114-CH19, tmgc48
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13616
HGNC: HGNC:3178
Homologene: 88
Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: fatty acid transport protein 4, FATP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Thoc7
Name: THO complex 7
Synonyms: 9230101K24Rik, 1500006O09Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66231
VEGA: 14
Homologene: 11821
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, 3110054G10Rik, D130023A07Rik, 2010321I05Rik, Tnrc6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Rnf169
Name: ring finger protein 169
Synonyms: 2900057K09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108937
Homologene: 47510
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 4,311,278 bp
  • A to G, chromosome 1 at 75,197,979 bp
  • A to T, chromosome 1 at 131,436,831 bp
  • T to A, chromosome 1 at 132,494,141 bp
  • A to G, chromosome 1 at 191,346,713 bp
  • T to C, chromosome 2 at 29,812,705 bp
  • T to C, chromosome 2 at 89,721,937 bp
  • A to G, chromosome 2 at 174,779,535 bp
  • C to T, chromosome 3 at 108,905,130 bp
  • T to C, chromosome 4 at 43,650,415 bp
  • A to T, chromosome 4 at 113,559,838 bp
  • A to C, chromosome 4 at 156,233,314 bp
  • G to A, chromosome 5 at 24,447,509 bp
  • A to G, chromosome 5 at 76,658,058 bp
  • A to T, chromosome 5 at 88,461,634 bp
  • G to T, chromosome 6 at 18,378,420 bp
  • G to T, chromosome 6 at 29,755,535 bp
  • A to T, chromosome 6 at 38,982,212 bp
  • A to G, chromosome 6 at 40,891,812 bp
  • A to G, chromosome 6 at 114,862,332 bp
  • G to A, chromosome 7 at 4,636,130 bp
  • A to G, chromosome 7 at 42,580,205 bp
  • T to A, chromosome 7 at 73,451,808 bp
  • T to A, chromosome 7 at 92,591,872 bp
  • T to C, chromosome 7 at 99,980,238 bp
  • A to T, chromosome 7 at 104,148,841 bp
  • T to C, chromosome 7 at 104,387,551 bp
  • A to G, chromosome 7 at 123,173,450 bp
  • A to G, chromosome 7 at 141,209,530 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCTACAGCCTCC to CACAGCCTCC, chromosome 7 at 142,144,284 bp
  • A to G, chromosome 8 at 72,382,790 bp
  • A to T, chromosome 8 at 107,047,149 bp
  • C to T, chromosome 9 at 20,800,289 bp
  • T to C, chromosome 9 at 37,855,018 bp
  • T to G, chromosome 9 at 39,258,466 bp
  • A to G, chromosome 9 at 51,840,502 bp
  • G to T, chromosome 9 at 110,419,765 bp
  • A to G, chromosome 9 at 119,344,498 bp
  • T to A, chromosome 9 at 123,779,469 bp
  • C to T, chromosome 11 at 7,144,762 bp
  • T to A, chromosome 13 at 9,735,398 bp
  • A to G, chromosome 13 at 97,978,495 bp
  • A to C, chromosome 14 at 13,951,204 bp
  • T to A, chromosome 14 at 54,200,403 bp
  • C to T, chromosome 14 at 70,490,122 bp
  • T to A, chromosome 14 at 78,925,246 bp
  • G to A, chromosome 15 at 35,910,524 bp
  • T to C, chromosome 16 at 38,768,014 bp
  • G to T, chromosome 16 at 77,077,201 bp
  • T to C, chromosome 19 at 12,298,677 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7500 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045573-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.