Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7500Btlr/Mmmh
Stock Number:
045573-MU
Citation ID:
RRID:MMRRC_045573-MU
Other Names:
R7500 (G1)
Major Collection:

Strain Information

Edn3
Name: endothelin 3
Synonyms: 114CH19, 114-CH19, tmgc48
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13616
HGNC: HGNC:3178
Homologene: 88
Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: fatty acid transport protein 4, FATP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Thoc7
Name: THO complex 7
Synonyms: 9230101K24Rik, 1500006O09Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66231
VEGA: 14
Homologene: 11821
Srgap2
Name: SLIT-ROBO Rho GTPase activating protein 2
Synonyms: FBP2, 9930124L22Rik, Fnbp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14270
Homologene: 52683
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, 3110054G10Rik, D130023A07Rik, 2010321I05Rik, Tnrc6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Rnf169
Name: ring finger protein 169
Synonyms: 2900057K09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108937
Homologene: 47510
Rbbp5
Name: retinoblastoma binding protein 5, histone lysine methyltransferase complex subunit
Synonyms: 4933411J24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213464
HGNC: HGNC:9888
Homologene: 3709
Eps15l1
Name: epidermal growth factor receptor pathway substrate 15-like 1
Synonyms: Eps15R, 9830147J04Rik, Eps15-rs
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13859
Homologene: 31881
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Bmp1
Name: bone morphogenetic protein 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12153
VEGA: 14
HGNC: HGNC:1067
Homologene: 55955
Chd2
Name: chromodomain helicase DNA binding protein 2
Synonyms: 2810040A01Rik, 2810013C04Rik, 5630401D06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244059
HGNC: HGNC:1917
Homologene: 37462
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Ppp6r1
Name: protein phosphatase 6, regulatory subunit 1
Synonyms: 2010309P17Rik, B430201G11Rik, Pp6r1, Saps1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243819
Homologene: 86982
Tmub1
Name: transmembrane and ubiquitin-like domain containing 1
Synonyms: Hops, 2010004O20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64295
Homologene: 11187
Zmynd11
Name: zinc finger, MYND domain containing 11
Synonyms: 2210402G22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66505
Homologene: 4828
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: RIP2, RhoGEF, Rho specific exchange factor, D13Bwg1089e, 9230110L08Rik, p190RhoGEF, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Arhgap20
Name: Rho GTPase activating protein 20
Synonyms: 6530403F17Rik, A530023E23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244867
Homologene: 18938
Col5a3
Name: collagen, type V, alpha 3
Synonyms: Pro-alpha3(V)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53867
Homologene: 9253
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Npr2
Name: natriuretic peptide receptor 2
Synonyms: guanylyl cyclase-B, cn, pwe
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230103
HGNC: HGNC:7944
Homologene: 2970
Ubqlnl
Name: ubiquilin-like
Synonyms: LOC244179, 4922504M18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244179
Homologene: 17034
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194357
Homologene: 77226
Plekhn1
Name: pleckstrin homology domain containing, family N member 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 231002
VEGA: 4
Homologene: 12949
Ankrd42
Name: ankyrin repeat domain 42
Synonyms: 4933417L02Rik, Ikbn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73845
Homologene: 23652
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
Trim30c
Name: tripartite motif-containing 30C
Synonyms: Trim30-2, Gm5598
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434219
Ankzf1
Name: ankyrin repeat and zinc finger domain containing 1
Synonyms: 1300008P06Rik, 2810025E10Rik, D1Ertd161e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 52231
Homologene: 41225
Ngp
Name: neutrophilic granule protein
Synonyms: clone B6, myeloid granule protein, bectenecin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18054
Homologene: 49180
Tbxas1
Name: thromboxane A synthase 1, platelet
Synonyms: TXS, CYP5A1, CYP5, TXAS
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21391
Homologene: 130979
Ccr9
Name: C-C motif chemokine receptor 9
Synonyms: GPR-9-6, Cmkbr10
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12769
HGNC: HGNC:1610
Homologene: 22546
Prpf38b
Name: PRP38 pre-mRNA processing factor 38 (yeast) domain containing B
Synonyms: 1110021E09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66921
Homologene: 9986
Smo
Name: smoothened, frizzled class receptor
Synonyms: E130215L21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 319757
Homologene: 4115
Lrrc56
Name: leucine rich repeat containing 56
Synonyms: 5730427C23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70552
Homologene: 115748
Acaa1a
Name: acetyl-Coenzyme A acyltransferase 1A
Synonyms: peroxisomal 3-ketoacyl-CoA thiolase, PTL, D9Ertd25e, Acaa1, thiolase A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 113868
HGNC: HGNC:82
Homologene: 37497
Zfp977
Name: zinc finger protein 977
Synonyms: Gm7221
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637776
Or5an10
Name: olfactory receptor family 5 subfamily AN member 10
Synonyms: GA_x6K02T2RE5P-2634596-2633658, MOR214-2, Olfr1436
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258682
Homologene: 83129
B4galt4
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Synonyms: 9130402O08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 56375
HGNC: HGNC:927
Homologene: 37848
Or8b9
Name: olfactory receptor family 8 subfamily B member 9
Synonyms: GA_x6K02T2PVTD-31540342-31541277, MOR161-5, Olfr877
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258412
Homologene: 121556
Vgll4
Name: vestigial like family member 4
Synonyms: VGL-4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232334
Homologene: 18603
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Pacc1
Name: proton activated chloride channel 1
Synonyms: 2310028N02Rik, Tmem206
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66950
Homologene: 10097
Or8g28
Name: olfactory receptor family 8 subfamily G member 28
Synonyms: GA_x6K02T2PVTD-32955932-32954982, MOR171-20, Olfr945
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258499
VEGA: 9
HGNC: HGNC:8484
Homologene: 133643
Or4a79
Name: olfactory receptor family 4 subfamily A member 79
Synonyms: GA_x6K02T2Q125-51162884-51161940, MOR231-22_p, Olfr1252
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404331
Homologene: 128094
Pdf
Name: peptide deformylase (mitochondrial)
Synonyms: 2610019N19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68023
Homologene: 69354
Krtap5-25
Name: keratin associated protein 5-25
Synonyms: Gm45337
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 115486481
Traj19
Name: T cell receptor alpha joining 19
Synonyms: Gm16655
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100124370
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 4,311,278 bp
  • A to G, chromosome 1 at 75,197,979 bp
  • A to T, chromosome 1 at 131,436,831 bp
  • T to A, chromosome 1 at 132,494,141 bp
  • A to G, chromosome 1 at 191,346,713 bp
  • T to C, chromosome 2 at 29,812,705 bp
  • T to C, chromosome 2 at 89,721,937 bp
  • A to G, chromosome 2 at 174,779,535 bp
  • C to T, chromosome 3 at 108,905,130 bp
  • T to C, chromosome 4 at 43,650,415 bp
  • A to T, chromosome 4 at 113,559,838 bp
  • A to C, chromosome 4 at 156,233,314 bp
  • G to A, chromosome 5 at 24,447,509 bp
  • A to G, chromosome 5 at 76,658,058 bp
  • A to T, chromosome 5 at 88,461,634 bp
  • G to T, chromosome 6 at 18,378,420 bp
  • G to T, chromosome 6 at 29,755,535 bp
  • A to T, chromosome 6 at 38,982,212 bp
  • A to G, chromosome 6 at 40,891,812 bp
  • A to G, chromosome 6 at 114,862,332 bp
  • G to A, chromosome 7 at 4,636,130 bp
  • A to G, chromosome 7 at 42,580,205 bp
  • T to A, chromosome 7 at 73,451,808 bp
  • T to A, chromosome 7 at 92,591,872 bp
  • T to C, chromosome 7 at 99,980,238 bp
  • A to T, chromosome 7 at 104,148,841 bp
  • T to C, chromosome 7 at 104,387,551 bp
  • A to G, chromosome 7 at 123,173,450 bp
  • A to G, chromosome 7 at 141,209,530 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCTACAGCCTCC to CACAGCCTCC, chromosome 7 at 142,144,284 bp
  • A to G, chromosome 8 at 72,382,790 bp
  • A to T, chromosome 8 at 107,047,149 bp
  • C to T, chromosome 9 at 20,800,289 bp
  • T to C, chromosome 9 at 37,855,018 bp
  • T to G, chromosome 9 at 39,258,466 bp
  • A to G, chromosome 9 at 51,840,502 bp
  • G to T, chromosome 9 at 110,419,765 bp
  • A to G, chromosome 9 at 119,344,498 bp
  • T to A, chromosome 9 at 123,779,469 bp
  • C to T, chromosome 11 at 7,144,762 bp
  • T to A, chromosome 13 at 9,735,398 bp
  • A to G, chromosome 13 at 97,978,495 bp
  • A to C, chromosome 14 at 13,951,204 bp
  • T to A, chromosome 14 at 54,200,403 bp
  • C to T, chromosome 14 at 70,490,122 bp
  • T to A, chromosome 14 at 78,925,246 bp
  • G to A, chromosome 15 at 35,910,524 bp
  • T to C, chromosome 16 at 38,768,014 bp
  • G to T, chromosome 16 at 77,077,201 bp
  • T to C, chromosome 19 at 12,298,677 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7500 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045573-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.