Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7502Btlr/Mmmh
Stock Number:
045575-MU
Citation ID:
RRID:MMRRC_045575-MU
Other Names:
R7502 (G1)
Major Collection:

Strain Information

Cntnap2
Name: contactin associated protein-like 2
Synonyms: 5430425M22Rik, Caspr2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66797
Homologene: 69159
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Mtss1
Name: MTSS I-BAR domain containing 1
Synonyms: MIM, D130001D01Rik, 2310003N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 211401
VEGA: 15
Homologene: 8841
Plaat1
Name: phospholipase A and acyltransferase 1
Synonyms: A-C1, 2810012B06Rik, Hrasls
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27281
Homologene: 8452
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Kif11
Name: kinesin family member 11
Synonyms: Eg5, Knsl1, Kifl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16551
VEGA: 19
HGNC: HGNC:6388
Homologene: 3322
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 6,827,970 bp
  • T to C, chromosome 1 at 45,918,974 bp
  • A to G, chromosome 1 at 135,469,666 bp
  • A to T, chromosome 1 at 154,468,988 bp
  • T to C, chromosome 1 at 160,110,359 bp
  • T to C, chromosome 1 at 170,908,641 bp
  • T to C, chromosome 1 at 176,756,029 bp
  • G to A, chromosome 1 at 181,510,878 bp
  • A to G, chromosome 2 at 43,780,618 bp
  • A to T, chromosome 2 at 69,776,144 bp
  • T to C, chromosome 2 at 90,015,011 bp
  • C to T, chromosome 2 at 91,004,755 bp
  • G to A, chromosome 2 at 112,712,361 bp
  • A to C, chromosome 2 at 117,263,863 bp
  • T to C, chromosome 2 at 120,091,393 bp
  • T to A, chromosome 2 at 120,174,338 bp
  • T to A, chromosome 2 at 121,453,769 bp
  • C to T, chromosome 2 at 164,579,841 bp
  • T to C, chromosome 2 at 172,551,719 bp
  • A to T, chromosome 3 at 107,671,197 bp
  • T to A, chromosome 3 at 108,398,902 bp
  • T to A, chromosome 4 at 22,376,655 bp
  • T to C, chromosome 4 at 43,706,316 bp
  • T to C, chromosome 4 at 58,785,648 bp
  • T to C, chromosome 4 at 59,894,567 bp
  • T to A, chromosome 4 at 63,851,161 bp
  • T to A, chromosome 4 at 100,333,630 bp
  • C to T, chromosome 4 at 139,412,672 bp
  • C to T, chromosome 4 at 149,906,928 bp
  • T to C, chromosome 4 at 154,666,926 bp
  • T to C, chromosome 4 at 155,250,336 bp
  • A to T, chromosome 5 at 30,622,718 bp
  • C to T, chromosome 5 at 35,706,062 bp
  • G to A, chromosome 5 at 108,443,780 bp
  • A to T, chromosome 5 at 112,475,481 bp
  • T to A, chromosome 5 at 145,005,921 bp
  • A to C, chromosome 5 at 149,630,373 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to C, chromosome 6 at 18,214,296 bp
  • T to C, chromosome 6 at 32,968,229 bp
  • T to A, chromosome 6 at 46,484,029 bp
  • A to G, chromosome 6 at 87,066,689 bp
  • A to T, chromosome 6 at 108,383,678 bp
  • A to T, chromosome 7 at 12,415,798 bp
  • G to A, chromosome 7 at 28,395,868 bp
  • A to T, chromosome 7 at 43,636,874 bp
  • A to T, chromosome 7 at 46,298,615 bp
  • A to G, chromosome 7 at 79,094,203 bp
  • A to G, chromosome 7 at 111,033,926 bp
  • A to G, chromosome 7 at 126,961,743 bp
  • T to C, chromosome 7 at 135,700,783 bp
  • A to G, chromosome 7 at 139,214,832 bp
  • A to G, chromosome 8 at 12,396,913 bp
  • A to G, chromosome 8 at 12,641,207 bp
  • A to G, chromosome 8 at 72,707,393 bp
  • C to A, chromosome 8 at 119,501,081 bp
  • A to T, chromosome 9 at 100,468,426 bp
  • C to T, chromosome 9 at 105,875,876 bp
  • C to A, chromosome 9 at 110,305,308 bp
  • A to G, chromosome 10 at 5,333,446 bp
  • T to G, chromosome 10 at 67,232,015 bp
  • T to A, chromosome 10 at 80,606,421 bp
  • A to G, chromosome 11 at 5,524,683 bp
  • T to C, chromosome 11 at 58,994,809 bp
  • T to C, chromosome 11 at 74,317,184 bp
  • T to C, chromosome 11 at 85,022,898 bp
  • T to C, chromosome 11 at 106,247,739 bp
  • T to C, chromosome 12 at 55,304,421 bp
  • G to A, chromosome 12 at 76,094,326 bp
  • G to T, chromosome 13 at 6,560,622 bp
  • G to T, chromosome 13 at 22,502,018 bp
  • A to T, chromosome 13 at 49,147,244 bp
  • A to T, chromosome 13 at 64,367,068 bp
  • T to G, chromosome 14 at 56,156,827 bp
  • A to G, chromosome 15 at 58,948,361 bp
  • A to G, chromosome 15 at 88,933,436 bp
  • G to A, chromosome 16 at 11,087,878 bp
  • T to C, chromosome 16 at 29,228,167 bp
  • T to A, chromosome 17 at 23,882,641 bp
  • C to A, chromosome 17 at 28,008,140 bp
  • T to C, chromosome 17 at 35,162,310 bp
  • T to A, chromosome 17 at 37,660,231 bp
  • T to C, chromosome 17 at 42,669,657 bp
  • T to A, chromosome 18 at 37,756,501 bp
  • T to C, chromosome 19 at 4,748,082 bp
  • G to C, chromosome 19 at 7,926,382 bp
  • A to T, chromosome 19 at 33,976,606 bp
  • T to A, chromosome 19 at 37,409,807 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7502 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045575-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.