Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7568Btlr/Mmmh
Stock Number:
045630-MU
Citation ID:
RRID:MMRRC_045630-MU
Other Names:
R7568 (G1)
Major Collection:

Strain Information

Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Comp
Name: cartilage oligomeric matrix protein
Synonyms: thrombospondin-5, TSP5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12845
HGNC: HGNC:2227
Homologene: 74
Cyfip1
Name: cytoplasmic FMR1 interacting protein 1
Synonyms: P140SRA-1, Shyc, pl-1, l(7)1Rl, Sra-1, E030028J09Rik, l7Rl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20430
Homologene: 22628
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 46,835,130 bp
  • G to T, chromosome 1 at 74,368,930 bp
  • A to T, chromosome 2 at 5,922,087 bp
  • T to A, chromosome 2 at 14,400,128 bp
  • T to C, chromosome 2 at 110,950,293 bp
  • A to T, chromosome 2 at 121,337,615 bp
  • C to T, chromosome 2 at 131,072,682 bp
  • A to G, chromosome 2 at 131,245,475 bp
  • A to G, chromosome 2 at 165,514,882 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • GTCACTGGTTCTGTGGTCACTGGTTCTGTG to GTCACTGGTTCTGTGATCACTGGTTCTGTGGTCACTGGTTCTGTG, chromosome 3 at 95,888,151 bp
  • GGTTCTGTGGTCACT to GGTTCTGTGGTCACTAGTTCTGTGGTCACT, chromosome 3 at 95,888,172 bp
  • A to T, chromosome 4 at 56,744,498 bp
  • T to C, chromosome 5 at 113,957,380 bp
  • T to C, chromosome 5 at 115,150,122 bp
  • A to G, chromosome 6 at 57,404,828 bp
  • G to A, chromosome 6 at 58,843,810 bp
  • T to A, chromosome 6 at 68,736,493 bp
  • A to G, chromosome 6 at 86,365,802 bp
  • T to G, chromosome 6 at 91,724,851 bp
  • A to G, chromosome 7 at 55,872,249 bp
  • A to G, chromosome 7 at 140,335,982 bp
  • A to G, chromosome 8 at 70,373,859 bp
  • A to G, chromosome 9 at 38,449,646 bp
  • C to A, chromosome 9 at 109,439,589 bp
  • A to G, chromosome 10 at 59,223,299 bp
  • A to T, chromosome 10 at 79,017,507 bp
  • T to C, chromosome 10 at 128,125,270 bp
  • T to C, chromosome 11 at 41,916,292 bp
  • C to A, chromosome 11 at 62,875,168 bp
  • T to C, chromosome 11 at 97,030,886 bp
  • T to A, chromosome 11 at 99,492,800 bp
  • T to C, chromosome 11 at 100,875,024 bp
  • A to G, chromosome 11 at 106,548,736 bp
  • T to A, chromosome 12 at 5,010,390 bp
  • A to G, chromosome 12 at 55,491,761 bp
  • A to T, chromosome 13 at 21,982,626 bp
  • G to A, chromosome 13 at 95,514,014 bp
  • T to A, chromosome 13 at 111,255,422 bp
  • C to A, chromosome 14 at 31,152,595 bp
  • G to A, chromosome 16 at 4,126,489 bp
  • T to C, chromosome 16 at 38,828,447 bp
  • A to G, chromosome 16 at 52,268,386 bp
  • C to A, chromosome 16 at 81,589,801 bp
  • A to G, chromosome 17 at 35,684,282 bp
  • A to G, chromosome 17 at 37,362,605 bp
  • A to T, chromosome 17 at 51,782,724 bp
  • A to G, chromosome 17 at 55,897,886 bp
  • T to A, chromosome 19 at 9,989,275 bp
  • T to C, chromosome 19 at 41,601,635 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7568 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045630-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.