Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7581Btlr/Mmmh
Stock Number:
045634-MU
Citation ID:
RRID:MMRRC_045634-MU
Other Names:
R7581 (G1)
Major Collection:

Strain Information

Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Plekha1
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Synonyms: TAPP1, C920009D07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101476
Homologene: 11001
Arid1a
Name: AT-rich interaction domain 1A
Synonyms: Osa1, 1110030E03Rik, Smarcf1, BAF250a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 93760
Homologene: 21216
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Pip5k1c
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Synonyms: PIP5KIgamma
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18717
HGNC: HGNC:8996
Homologene: 69032
Afdn
Name: afadin, adherens junction formation factor
Synonyms: AF6, Afadin, S-afadin, I-afadin, 5033403D15Rik, Mllt4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 93,256,545 bp
  • G to A, chromosome 1 at 174,158,771 bp
  • A to T, chromosome 2 at 44,790,005 bp
  • A to G, chromosome 2 at 92,370,193 bp
  • G to T, chromosome 2 at 101,643,304 bp
  • A to G, chromosome 2 at 112,753,027 bp
  • A to T, chromosome 2 at 130,141,285 bp
  • A to T, chromosome 2 at 168,183,466 bp
  • A to C, chromosome 3 at 51,856,768 bp
  • T to C, chromosome 4 at 48,421,909 bp
  • T to C, chromosome 4 at 117,885,286 bp
  • A to T, chromosome 4 at 133,680,351 bp
  • T to C, chromosome 4 at 140,728,929 bp
  • T to C, chromosome 4 at 156,245,449 bp
  • A to G, chromosome 5 at 77,326,704 bp
  • G to A, chromosome 5 at 109,690,788 bp
  • A to T, chromosome 5 at 110,756,025 bp
  • A to G, chromosome 5 at 123,816,755 bp
  • GCACATCAGGATCC to GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC, chromosome 6 at 4,756,452 bp
  • T to C, chromosome 6 at 53,681,237 bp
  • A to T, chromosome 6 at 91,498,017 bp
  • A to C, chromosome 6 at 92,937,338 bp
  • C to T, chromosome 6 at 122,063,711 bp
  • T to A, chromosome 6 at 149,519,004 bp
  • G to T, chromosome 7 at 15,922,382 bp
  • A to T, chromosome 7 at 22,437,904 bp
  • T to G, chromosome 7 at 26,938,148 bp
  • A to T, chromosome 7 at 64,204,555 bp
  • A to G, chromosome 7 at 105,433,786 bp
  • A to G, chromosome 7 at 130,910,865 bp
  • A to T, chromosome 7 at 140,835,627 bp
  • A to G, chromosome 8 at 110,726,213 bp
  • A to G, chromosome 9 at 6,293,894 bp
  • T to C, chromosome 9 at 18,645,614 bp
  • T to A, chromosome 9 at 21,062,708 bp
  • A to T, chromosome 9 at 40,000,422 bp
  • A to G, chromosome 9 at 53,372,557 bp
  • T to C, chromosome 9 at 57,592,042 bp
  • C to A, chromosome 10 at 23,961,154 bp
  • T to C, chromosome 10 at 77,711,563 bp
  • A to G, chromosome 10 at 81,308,960 bp
  • C to A, chromosome 11 at 102,914,722 bp
  • A to T, chromosome 12 at 66,506,255 bp
  • A to G, chromosome 13 at 59,704,139 bp
  • C to T, chromosome 16 at 17,301,060 bp
  • T to C, chromosome 16 at 78,546,557 bp
  • T to C, chromosome 17 at 13,849,238 bp
  • A to G, chromosome 17 at 22,747,274 bp
  • T to G, chromosome 18 at 35,979,997 bp
  • A to T, chromosome 18 at 37,662,177 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7581 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045634-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.