Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7581Btlr/Mmmh
Stock Number:
045634-MU
Citation ID:
RRID:MMRRC_045634-MU
Other Names:
R7581 (G1)
Major Collection:

Strain Information

Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Plekha1
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
Synonyms: TAPP1, C920009D07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101476
Homologene: 11001
Arid1a
Name: AT-rich interaction domain 1A
Synonyms: Osa1, 1110030E03Rik, Smarcf1, BAF250a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 93760
Homologene: 21216
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Pip5k1c
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 gamma
Synonyms: PIP5KIgamma
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18717
HGNC: HGNC:8996
Homologene: 69032
Afdn
Name: afadin, adherens junction formation factor
Synonyms: AF6, Afadin, S-afadin, I-afadin, 5033403D15Rik, Mllt4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Bicd1
Name: BICD cargo adaptor 1
Synonyms: B830009D06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12121
HGNC: HGNC:1049
Homologene: 37518
Adnp
Name: activity-dependent neuroprotective protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11538
Homologene: 7617
Rag1
Name: recombination activating 1
Synonyms: Rag-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19373
HGNC: HGNC:9831
Homologene: 387
Polr2b
Name: polymerase (RNA) II (DNA directed) polypeptide B
Synonyms: RPB2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231329
HGNC: HGNC:9188
Homologene: 722
Cckbr
Name: cholecystokinin B receptor
Synonyms: CCK-B/gastrin receptor, CCK2/gastrin, CCK2R, CCKR-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12426
HGNC: HGNC:1571
Homologene: 7258
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
D16Ertd472e
Name: DNA segment, Chr 16, ERATO Doi 472, expressed
Synonyms: 2310009O17Rik, E330003K22Rik, 1700010I10Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67102
Homologene: 9696
Kif18b
Name: kinesin family member 18B
Synonyms: N-8 kinesin, 3000004C01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70218
Homologene: 15214
Pdgfd
Name: platelet-derived growth factor, D polypeptide
Synonyms: 1110003I09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71785
VEGA: 9
Homologene: 11875
Selenow
Name: selenoprotein W
Synonyms: Sepw1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20364
Homologene: 2263
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Zglp1
Name: zinc finger, GATA-like protein 1
Synonyms: Glp1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100009600
VEGA: 9
Homologene: 104472
Large2
Name: LARGE xylosyl- and glucuronyltransferase 2
Synonyms: 5730485C17Rik, Gyltl1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228366
Homologene: 27362
Exph5
Name: exophilin 5
Synonyms: slac2-b, B130009M24Rik, AC079869.22gm5, Slac2b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320051
Homologene: 9007
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Ulk3
Name: unc-51-like kinase 3
Synonyms: 1200015E14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71742
VEGA: 9
Homologene: 68482
Xpc
Name: xeroderma pigmentosum, complementation group C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22591
Homologene: 3401
Adamts9
Name: ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms: 1810011L16Rik, E030027K14Rik, 8430403M15Rik, Mhdaund4, Gsfund3, UND3, Mhdaund3, UND4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101401
Homologene: 18821
Urah
Name: urate (5-hydroxyiso-) hydrolase
Synonyms: 2810420C16Rik, HIU hydrolase, 1190003J15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76974
Homologene: 45975
Padi6
Name: peptidyl arginine deiminase, type VI
Synonyms: ePAD, Padi5, Pad6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242726
Homologene: 17695
Taar4
Name: trace amine-associated receptor 4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209513
Homologene: 45509
Psd2
Name: pleckstrin and Sec7 domain containing 2
Synonyms: 6330404E20Rik, EFA6C
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 74002
Homologene: 12522
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Gtdc1
Name: glycosyltransferase-like domain containing 1
Synonyms: E330008O22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227835
Homologene: 32590
Tgm6
Name: transglutaminase 6
Synonyms: TGM3L
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241636
Homologene: 27970
Atp6v0b
Name: ATPase, H+ transporting, lysosomal V0 subunit B
Synonyms: 2310024H13Rik, VMA16, Atp6f
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 114143
HGNC: HGNC:861
Homologene: 2986
Sned1
Name: sushi, nidogen and EGF-like domains 1
Synonyms: Snep, 6720455I24Rik, D430044C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208777
Homologene: 14708
Creb5
Name: cAMP responsive element binding protein 5
Synonyms: D430026C09Rik, Crebpa, 9430076C15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231991
Homologene: 18215
Mtss2
Name: MTSS I-BAR domain containing 2
Synonyms: ABBA, Mtss1l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244654
Homologene: 70926
Or6k2
Name: olfactory receptor family 6 subfamily K member 2
Synonyms: GA_x6K02T2P20D-20995211-20994246, MOR105-10, Olfr420
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258302
Homologene: 17185
Maml3
Name: mastermind like transcriptional coactivator 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433586
Homologene: 41284
Or10g9
Name: olfactory receptor family 10 subfamily G member 9
Synonyms: GA_x6K02T2PVTD-33699706-33698771, MOR223-1, Olfr979
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259112
VEGA: 9
Homologene: 81556
Krtap12-22
Name: keratin associated protein 12-22
Synonyms: Gm10024
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100009614
VEGA: 10
Homologene: 135713
Cyp2a22
Name: cytochrome P450, family 2, subfamily a, polypeptide 22
Synonyms: EG233005
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233005
Homologene: 69128
Pcdhga1
Name: protocadherin gamma subfamily A, 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93709
HGNC: HGNC:8696
Homologene: 56824
Spata31d1a
Name: spermatogenesis associated 31 subfamily D, member 1A
Synonyms: 1700013B16Rik, Fam75d1a, Fam75d3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72219
VEGA: 13
Homologene: 122131
Noc2l
Name: NOC2 like nucleolar associated transcriptional repressor
Synonyms: NIR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 57741
VEGA: 4
Homologene: 6980
Vmn1r149
Name: vomeronasal 1 receptor 149
Synonyms: Gm4194
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043051
Homologene: 104166
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 93,256,545 bp
  • G to A, chromosome 1 at 174,158,771 bp
  • A to T, chromosome 2 at 44,790,005 bp
  • A to G, chromosome 2 at 92,370,193 bp
  • G to T, chromosome 2 at 101,643,304 bp
  • A to G, chromosome 2 at 112,753,027 bp
  • A to T, chromosome 2 at 130,141,285 bp
  • A to T, chromosome 2 at 168,183,466 bp
  • A to C, chromosome 3 at 51,856,768 bp
  • T to C, chromosome 4 at 48,421,909 bp
  • T to C, chromosome 4 at 117,885,286 bp
  • A to T, chromosome 4 at 133,680,351 bp
  • T to C, chromosome 4 at 140,728,929 bp
  • T to C, chromosome 4 at 156,245,449 bp
  • A to G, chromosome 5 at 77,326,704 bp
  • G to A, chromosome 5 at 109,690,788 bp
  • A to T, chromosome 5 at 110,756,025 bp
  • A to G, chromosome 5 at 123,816,755 bp
  • GCACATCAGGATCC to GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC, chromosome 6 at 4,756,452 bp
  • T to C, chromosome 6 at 53,681,237 bp
  • A to T, chromosome 6 at 91,498,017 bp
  • A to C, chromosome 6 at 92,937,338 bp
  • C to T, chromosome 6 at 122,063,711 bp
  • T to A, chromosome 6 at 149,519,004 bp
  • G to T, chromosome 7 at 15,922,382 bp
  • A to T, chromosome 7 at 22,437,904 bp
  • T to G, chromosome 7 at 26,938,148 bp
  • A to T, chromosome 7 at 64,204,555 bp
  • A to G, chromosome 7 at 105,433,786 bp
  • A to G, chromosome 7 at 130,910,865 bp
  • A to T, chromosome 7 at 140,835,627 bp
  • A to G, chromosome 8 at 110,726,213 bp
  • A to G, chromosome 9 at 6,293,894 bp
  • T to C, chromosome 9 at 18,645,614 bp
  • T to A, chromosome 9 at 21,062,708 bp
  • A to T, chromosome 9 at 40,000,422 bp
  • A to G, chromosome 9 at 53,372,557 bp
  • T to C, chromosome 9 at 57,592,042 bp
  • C to A, chromosome 10 at 23,961,154 bp
  • T to C, chromosome 10 at 77,711,563 bp
  • A to G, chromosome 10 at 81,308,960 bp
  • C to A, chromosome 11 at 102,914,722 bp
  • A to T, chromosome 12 at 66,506,255 bp
  • A to G, chromosome 13 at 59,704,139 bp
  • C to T, chromosome 16 at 17,301,060 bp
  • T to C, chromosome 16 at 78,546,557 bp
  • T to C, chromosome 17 at 13,849,238 bp
  • A to G, chromosome 17 at 22,747,274 bp
  • T to G, chromosome 18 at 35,979,997 bp
  • A to T, chromosome 18 at 37,662,177 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7581 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045634-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.