Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7601Btlr/Mmmh
Stock Number:
045643-MU
Citation ID:
RRID:MMRRC_045643-MU
Other Names:
R7601 (G1)
Major Collection:

Strain Information

Sema7a
Name: sema domain, immunoglobulin domain (Ig), and GPI membrane anchor, (semaphorin) 7A
Synonyms: Semaphorin K1, CDw108, Semal, 2900057C09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20361
VEGA: 9
Homologene: 2678
2310061I04Rik
Name: RIKEN cDNA 2310061I04 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69662
Homologene: 17027
Lima1
Name: LIM domain and actin binding 1
Synonyms: 1110021C24Rik, 3526402A12Rik, epithelial protein lost in neoplasm, EPLIN
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 65970
Homologene: 9484
Tbc1d23
Name: TBC1 domain family, member 23
Synonyms: 4930451A13Rik, D030022P07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67581
VEGA: 16
Homologene: 10126
Pdcd11
Name: programmed cell death 11
Synonyms: ALG-4, 1110021I22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18572
VEGA: 19
Homologene: 74968
Als2
Name: alsin Rho guanine nucleotide exchange factor
Synonyms: 3222402C23Rik, Als2cr6, 9430073A21Rik, Alsin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74018
HGNC: HGNC:443
Homologene: 23264
Ubtf
Name: upstream binding transcription factor, RNA polymerase I
Synonyms: UBF1, Tcfubf, UBF, A930005G04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21429
Homologene: 7970
Abcc5
Name: ATP-binding cassette, sub-family C member 5
Synonyms: Mrp5, Abcc5b, Abcc5a, 2900011L11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27416
HGNC: HGNC:56
Homologene: 21164
Fam114a2
Name: family with sequence similarity 114, member A2
Synonyms: 9030624B09Rik, 1810073G14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67726
HGNC: HGNC:1333
Homologene: 10270
Calcr
Name: calcitonin receptor
Synonyms: Clr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12311
HGNC: HGNC:1440
Homologene: 1320
Pigh
Name: phosphatidylinositol glycan anchor biosynthesis, class H
Synonyms: A930028P05Rik, 2210416H01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110417
VEGA: 12
HGNC: HGNC:8964
Homologene: 3361
Dbr1
Name: debranching RNA lariats 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83703
Homologene: 9428
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215690
Homologene: 10719
Piezo1
Name: piezo-type mechanosensitive ion channel component 1
Synonyms: Piezo1, Fam38a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234839
Homologene: 124356
F10
Name: coagulation factor X
Synonyms: fX, Cf10, AI194738
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14058
HGNC: HGNC:3528
Homologene: 30976
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Slc45a1
Name: solute carrier family 45, member 1
Synonyms: Dnb5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242773
Homologene: 44908
Acot10
Name: acyl-CoA thioesterase 10
Synonyms: MT-ACT48, p48, Acate3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64833
VEGA: 15
Homologene: 8206
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, IPM200, Spacrcan
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224224
Homologene: 9439
Or4k37
Name: olfactory receptor family 4 subfamily K member 37
Synonyms: GA_x6K02T2Q125-72379864-72380781, MOR248-18, MOR248-14P, Olfr1281
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257979
Homologene: 73992
Or5k3
Name: olfactory receptor family 5 subfamily K member 3
Synonyms: GA_x54KRFPKG5P-55369823-55370749, MOR184-5, Olfr195
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 259000
Homologene: 128109
Abcd4
Name: ATP-binding cassette, sub-family D member 4
Synonyms: P69r, Pxmp1l
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19300
VEGA: 12
HGNC: HGNC:68
Homologene: 3703
Phtf1
Name: putative homeodomain transcription factor 1
Synonyms: Phft
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18685
HGNC: HGNC:8939
Homologene: 4817
Ccndbp1
Name: cyclin D-type binding-protein 1
Synonyms: stage specific embryonic cDNA-8, SSEC-8, Maid, DIP1, GCIP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17151
HGNC: HGNC:1587
Homologene: 7826
Hspa4l
Name: heat shock protein 4 like
Synonyms: APG-1, 94kDa, Osp94
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18415
Homologene: 22610
Ptges
Name: prostaglandin E synthase
Synonyms: 2410099E23Rik, D2Ertd369e, mPGES, mPGES-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64292
HGNC: HGNC:9599
Homologene: 3587
Lum
Name: lumican
Synonyms: Ldc, SLRR2D
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17022
VEGA: 10
HGNC: HGNC:6724
Homologene: 37614
Eeig2
Name: EEIG family member 2
Synonyms: 1600010D10Rik, B430201A12Rik, Fam102b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329739
Homologene: 46568
Nmur1
Name: neuromedin U receptor 1
Synonyms: FM-3, NmU-R, NMU1R, Gpr66
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14767
HGNC: HGNC:4518
Homologene: 68501
Trdn
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Pnliprp1
Name: pancreatic lipase related protein 1
Synonyms: Plrp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18946
VEGA: 19
HGNC: HGNC:9156
Homologene: 21253
Sp110
Name: Sp110 nuclear body protein
Synonyms: 52kDa, Ipr1, 5830484A20Rik, 5031415C07Rik, Ifi75
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109032
HGNC: HGNC:5401
Homologene: 82192
Dync1i1
Name: dynein cytoplasmic 1 intermediate chain 1
Synonyms: IC74, DIC, Dncic1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13426
HGNC: HGNC:2963
Homologene: 68398
Or8b41
Name: olfactory receptor family 8 subfamily B member 41
Synonyms: GA_x6K02T2PVTD-31822365-31823309, MOR162-3, MOR162-15_p, Olfr890
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258474
Homologene: 138311
Plekhf1
Name: pleckstrin homology domain containing, family F (with FYVE domain) member 1
Synonyms: 1810013P09Rik, LAPF
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72287
Homologene: 11516
Cdh22
Name: cadherin 22
Synonyms: PB-cadherin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104010
Homologene: 23148
Faim2
Name: Fas apoptotic inhibitory molecule 2
Synonyms: NMP25, 2900002L20Rik, lifeguard, Lfg, Tmbim2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72393
VEGA: 15
Homologene: 8192
Sephs2
Name: selenophosphate synthetase 2
Synonyms: Ysg3, Sps2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20768
Homologene: 7550
Cenps
Name: centromere protein S
Synonyms: 2810407L01Rik, 2610040C18Rik, Apitd1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69928
Homologene: 66004
Or10ad1c
Name: olfactory receptor family 10 subfamily AD member 1C
Synonyms: GA_x6K02T2NBG7-5568919-5569857, MOR286-3P, Olfr288
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545140
Homologene: 128379
Was
Name: Wiskott-Aldrich syndrome
Synonyms: Wasp, U42471
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 22376
Homologene: 30970
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 59,170,002 bp
  • G to A, chromosome 1 at 85,579,092 bp
  • A to C, chromosome 1 at 86,388,019 bp
  • A to T, chromosome 1 at 135,460,438 bp
  • T to A, chromosome 2 at 30,892,797 bp
  • T to C, chromosome 2 at 111,329,220 bp
  • T to C, chromosome 2 at 121,016,146 bp
  • A to G, chromosome 2 at 165,112,546 bp
  • T to C, chromosome 3 at 40,784,356 bp
  • T to A, chromosome 3 at 103,993,845 bp
  • T to A, chromosome 3 at 108,988,312 bp
  • A to G, chromosome 4 at 149,132,315 bp
  • A to T, chromosome 4 at 150,629,537 bp
  • A to T, chromosome 6 at 3,687,603 bp
  • T to A, chromosome 6 at 5,905,129 bp
  • T to C, chromosome 7 at 38,221,880 bp
  • A to T, chromosome 7 at 127,272,946 bp
  • A to G, chromosome 7 at 141,636,541 bp
  • A to G, chromosome 8 at 13,050,781 bp
  • C to T, chromosome 8 at 122,483,481 bp
  • T to C, chromosome 9 at 38,143,378 bp
  • T to C, chromosome 9 at 57,940,277 bp
  • T to C, chromosome 9 at 62,696,926 bp
  • G to T, chromosome 9 at 99,582,602 bp
  • A to G, chromosome 10 at 33,196,156 bp
  • A to T, chromosome 10 at 97,568,306 bp
  • T to C, chromosome 11 at 57,514,216 bp
  • G to A, chromosome 11 at 102,306,654 bp
  • G to A, chromosome 12 at 79,085,705 bp
  • A to G, chromosome 12 at 84,613,945 bp
  • T to C, chromosome 15 at 20,665,629 bp
  • G to A, chromosome 15 at 98,186,979 bp
  • C to T, chromosome 15 at 99,500,266 bp
  • G to A, chromosome 15 at 99,819,696 bp
  • A to T, chromosome 16 at 20,375,132 bp
  • A to T, chromosome 16 at 56,260,031 bp
  • A to T, chromosome 16 at 57,181,534 bp
  • A to G, chromosome 16 at 59,149,234 bp
  • A to G, chromosome 17 at 35,895,849 bp
  • T to C, chromosome 19 at 47,106,369 bp
  • C to T, chromosome 19 at 58,732,094 bp
  • GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC to GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC, chromosome X at 8,086,211 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7601 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045643-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.