Strain Name:
C57BL/6J-MtgxR7798Btlr/Mmmh
Stock Number:
045648-MU
Citation ID:
RRID:MMRRC_045648-MU
Other Names:
R7798 (G1)
Major Collection:

Strain Information

Ptk2
Name: PTK2 protein tyrosine kinase 2
Synonyms: Fadk, FAK, FRNK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14083
VEGA: 15
HGNC: HGNC:9611
Homologene: 7314
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Rpa1
Name: replication protein A1
Synonyms: Rpa, RF-A, RP-A, 5031405K23Rik, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68275
Homologene: 2208
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Marf1
Name: meiosis regulator and mRNA stability 1
Synonyms: 4921513D23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 223989
VEGA: 16
Homologene: 40967
Rxrb
Name: retinoid X receptor beta
Synonyms: RCoR-1, H-2RIIBP, Nr2b2, Rub
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20182
Homologene: 7923
Syn3
Name: synapsin III
Synonyms: Synapsin IIIa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27204
Homologene: 68320
Fgf23
Name: fibroblast growth factor 23
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64654
HGNC: HGNC:3680
Homologene: 10771
Sox2
Name: SRY (sex determining region Y)-box 2
Synonyms: Sox-2, lcc, ysb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20674
Homologene: 68298
Vegfa
Name: vascular endothelial growth factor A
Synonyms: VPF, VEGF-A, VEGF120, Vegf, VEGF188, VEGF164
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22339
Homologene: 2534
Ccdc88a
Name: coiled coil domain containing 88A
Synonyms: C330012F17Rik, D130005J21Rik, C130096N06Rik, GIV, HkRP1, Girdin, A430106J12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108686
Homologene: 41180
Tmem130
Name: transmembrane protein 130
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243339
Homologene: 17680
Ell3
Name: elongation factor RNA polymerase II-like 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269344
Homologene: 11859
Pde4a
Name: phosphodiesterase 4A, cAMP specific
Synonyms: dunce, Dpde2, D9Ertd60e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18577
HGNC: HGNC:8780
Homologene: 4520
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Cfap74
Name: cilia and flagella associated protein 74
Synonyms: 2010015L04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 544678
Homologene: 129584
Itpr2
Name: inositol 1,4,5-triphosphate receptor 2
Synonyms: Ip3r2, Itpr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16439
HGNC: HGNC:6181
Homologene: 37593
Or1n1
Name: olfactory receptor family 1 subfamily N member 1
Synonyms: GA_x6K02T2NLDC-33554926-33553994, MOR127-2, Olfr351
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258944
HGNC: HGNC:8221
Homologene: 10583
Intu
Name: inturned planar cell polarity protein
Synonyms: 9430087H23Rik, 9230116I04Rik, Pdzk6, Pdzd6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 380614
Homologene: 41059
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Or4f6
Name: olfactory receptor family 4 subfamily F member 6
Synonyms: GA_x6K02T2Q125-73056609-73055671, MOR245-3, Olfr1310
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258441
Homologene: 74053
Vmn2r2
Name: vomeronasal 2, receptor 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100125586
Homologene: 129753
Des
Name: desmin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13346
HGNC: HGNC:2770
Homologene: 56469
Sfmbt1
Name: Scm-like with four mbt domains 1
Synonyms: Smr, 4930442N21Rik, 9330180L21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 54650
Homologene: 9472
Abca9
Name: ATP-binding cassette, sub-family A member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Ugt2a3
Name: UDP glucuronosyltransferase 2 family, polypeptide A3
Synonyms: 2010321J07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72094
Homologene: 55988
Slco3a1
Name: solute carrier organic anion transporter family, member 3a1
Synonyms: MJAM, OATP-D, 5830414C08Rik, Anr1, Slc21a11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108116
Homologene: 40862
Abcc6
Name: ATP-binding cassette, sub-family C member 6
Synonyms: DCC, Mrp6, Dyscalc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
Dis3l
Name: DIS3 like exosome 3'-5' exoribonuclease
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 213550
Homologene: 15797
Ggt6
Name: gamma-glutamyltransferase 6
Synonyms: 9030405D14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71522
Homologene: 51918
Mgat4b
Name: mannoside acetylglucosaminyltransferase 4, isoenzyme B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103534
HGNC: HGNC:7048
Homologene: 8611
Nsun4
Name: NOL1/NOP2/Sun domain family, member 4
Synonyms: 2310010O12Rik, 2810405F18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72181
Homologene: 12455
Albfm1
Name: albumin superfamily member 1
Synonyms: ARG, Gm17754, 5830473C10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 622307
Homologene: 129803
Disp2
Name: dispatched RND transporter family member 2
Synonyms: DispB, B230210L08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214240
Homologene: 24916
Adamts15
Name: ADAM metallopeptidase with thrombospondin type 1 motif 15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235130
VEGA: 9
Homologene: 8610
Twnk
Name: twinkle mtDNA helicase
Synonyms: twinkle, Twinl, D19Ertd626e, Peo1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226153
VEGA: 19
HGNC: HGNC:1160
Homologene: 11052
Tgtp1
Name: T cell specific GTPase 1
Synonyms: Mg21, Gtp2, Tgtp, Irgb6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21822
Homologene: 129991
Tmem9
Name: transmembrane protein 9
Synonyms: 1500015G18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66241
Homologene: 9515
Spty2d1
Name: SPT2 chromatin protein domain containing 1
Synonyms: 5830435K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101685
Homologene: 45499
Clca3b
Name: chloride channel accessory 3B
Synonyms: Clca4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229927
HGNC: HGNC:2017
Homologene: 135610
Ube4a
Name: ubiquitination factor E4A
Synonyms: UFD2b, 9930123J21Rik, 4732444G18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 140630
Homologene: 3517
Clca3a1
Name: chloride channel accessory 3A1
Synonyms: Clca1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12722
HGNC: HGNC:2017
Homologene: 77224
Prob1
Name: proline rich basic protein 1
Synonyms: LOC381148, Gm1614
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381148
Homologene: 83773
Rgs6
Name: regulator of G-protein signaling 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 50779
Homologene: 68385
Gpr180
Name: G protein-coupled receptor 180
Synonyms: ITR, E130016I23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58245
VEGA: 14
Homologene: 32506
Vmn2r65
Name: vomeronasal 2, receptor 65
Synonyms: ENSMUSG00000070600
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100009609
Galnt15
Name: polypeptide N-acetylgalactosaminyltransferase 15
Synonyms: 4631401E18Rik, Galntl2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 78754
Homologene: 14286
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Best1
Name: bestrophin 1
Synonyms: best macular dystrophy, mBest1, Vmd2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24115
Homologene: 37895
Padi3
Name: peptidyl arginine deiminase, type III
Synonyms: PAD type III, Pad3, Pdi3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18601
Homologene: 7882
Arhgap11a
Name: Rho GTPase activating protein 11A
Synonyms: GAP (1-12), 6530401L14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228482
Homologene: 8862
Cyp21a1
Name: cytochrome P450, family 21, subfamily a, polypeptide 1
Synonyms: 21-OH, 21-hydroxylase, 21OH, Oh21-1, 21OHA, Cyp21, Oh21-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13079
Homologene: 68063
BC051665
Name: cDNA sequence BC051665
Synonyms: cathepsin L-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218275
VEGA: 13
Homologene: 74298
Or4k15
Name: olfactory receptor family 4 subfamily K member 15
Synonyms: GA_x6K02T2PMLR-5817082-5818056, MOR246-2, Olfr727
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258316
Homologene: 84571
Tmcc1
Name: transmembrane and coiled coil domains 1
Synonyms: 3632431M01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330401
Homologene: 8995
Adamts14
Name: ADAM metallopeptidase with thrombospondin type 1 motif 14
Synonyms: TS14, Adamts-14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237360
Homologene: 16383
Il1r1
Name: interleukin 1 receptor, type I
Synonyms: IL-1 receptor alpha chain, CD121a, Il1r-1, IL-iR, IL-1R1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16177
HGNC: HGNC:5993
Homologene: 677
Or12e1
Name: olfactory receptor family 12 subfamily E member 1
Synonyms: GA_x6K02T2Q125-48676316-48677272, MOR264-6, Olfr1112
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258655
Homologene: 64901
Cyb5r2
Name: cytochrome b5 reductase 2
Synonyms: D630003K02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320635
Homologene: 6182
Ttyh3
Name: tweety family member 3
Synonyms: 2900029G13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78339
Homologene: 18431
Gzma
Name: granzyme A
Synonyms: serine esterase 1, TSP1, BLT esterase, Hanukah factor, Hf, Ctla-3, Ctla3, H factor, SE1, TSP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14938
VEGA: 13
HGNC: HGNC:4708
Homologene: 21237
Sepsecs
Name: Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
Synonyms: SLA, D5Ertd135e, SecS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 211006
Homologene: 15031
1700088E04Rik
Name: RIKEN cDNA 1700088E04 gene
Synonyms: Mus EST J0827E04
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 27660
Homologene: 13062
Camk2b
Name: calcium/calmodulin-dependent protein kinase II, beta
Synonyms: CaMK II
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12323
HGNC: HGNC:1461
Homologene: 111050
Phactr3
Name: phosphatase and actin regulator 3
Synonyms: scapinin, 1500003N10Rik, 4930415A02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74189
Homologene: 14482
Nrk
Name: Nik related kinase
Synonyms: Nesk
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 27206
Homologene: 8442
Cyp2ab1
Name: cytochrome P450, family 2, subfamily ab, polypeptide 1
Synonyms: EG224044
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224044
Homologene: 120487
Igkv8-30
Name: immunoglobulin kappa chain variable 8-30
Synonyms: ENSMUSG00000073025, Gm10883
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 384419
HGNC: HGNC:5834
Sco1
Name: SCO1 cytochrome c oxidase assembly protein
Synonyms: 2610001C07Rik, D11Bwg1310e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52892
Homologene: 3374
Or12k7
Name: olfactory receptor family 12 subfamily K member 7
Synonyms: GA_x6K02T2NLDC-33760081-33761034, MOR159-1, Olfr360
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258615
Homologene: 73997
Cdhr17
Name: cadherin related family member 17
Synonyms: Gm28710
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 102640594
Homologene: 141132
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 40,310,366 bp
  • T to C, chromosome 1 at 75,362,359 bp
  • C to A, chromosome 1 at 136,034,189 bp
  • G to A, chromosome 2 at 20,781,946 bp
  • T to C, chromosome 2 at 36,860,336 bp
  • A to T, chromosome 2 at 37,069,174 bp
  • A to T, chromosome 2 at 87,192,292 bp
  • A to G, chromosome 2 at 112,008,272 bp
  • A to C, chromosome 2 at 113,843,335 bp
  • A to C, chromosome 2 at 118,791,879 bp
  • TCTCCTC to TCTC, chromosome 2 at 121,439,456 bp
  • G to A, chromosome 2 at 178,283,910 bp
  • G to A, chromosome 3 at 34,650,642 bp
  • T to C, chromosome 3 at 40,691,929 bp
  • C to A, chromosome 3 at 64,134,097 bp
  • T to A, chromosome 3 at 144,757,962 bp
  • T to C, chromosome 3 at 144,828,130 bp
  • T to G, chromosome 4 at 116,051,174 bp
  • T to C, chromosome 4 at 123,378,100 bp
  • C to T, chromosome 4 at 140,786,439 bp
  • T to A, chromosome 4 at 155,422,622 bp
  • T to C, chromosome 5 at 16,856,658 bp
  • T to C, chromosome 5 at 52,647,189 bp
  • T to C, chromosome 5 at 87,327,723 bp
  • T to C, chromosome 5 at 90,597,511 bp
  • T to A, chromosome 5 at 123,786,294 bp
  • T to A, chromosome 5 at 123,819,117 bp
  • C to T, chromosome 5 at 140,634,783 bp
  • T to G, chromosome 5 at 144,743,770 bp
  • A to T, chromosome 6 at 70,117,371 bp
  • A to T, chromosome 6 at 116,043,578 bp
  • A to T, chromosome 6 at 127,073,214 bp
  • A to G, chromosome 6 at 146,386,015 bp
  • C to A, chromosome 7 at 45,976,853 bp
  • G to A, chromosome 7 at 46,996,056 bp
  • A to G, chromosome 7 at 74,318,596 bp
  • G to T, chromosome 7 at 84,946,322 bp
  • A to G, chromosome 7 at 84,946,984 bp
  • A to T, chromosome 7 at 107,753,948 bp
  • A to T, chromosome 7 at 118,171,939 bp
  • T to C, chromosome 7 at 141,794,041 bp
  • C to T, chromosome 8 at 33,581,847 bp
  • A to G, chromosome 9 at 21,198,663 bp
  • G to A, chromosome 9 at 30,904,643 bp
  • A to G, chromosome 9 at 44,933,331 bp
  • G to T, chromosome 9 at 64,341,017 bp
  • A to T, chromosome 10 at 61,271,173 bp
  • A to G, chromosome 10 at 86,080,253 bp
  • A to T, chromosome 10 at 86,957,912 bp
  • A to G, chromosome 11 at 5,978,399 bp
  • A to G, chromosome 11 at 9,291,664 bp
  • C to A, chromosome 11 at 29,477,348 bp
  • A to G, chromosome 11 at 48,987,332 bp
  • A to G, chromosome 11 at 50,225,670 bp
  • A to G, chromosome 11 at 67,053,802 bp
  • A to T, chromosome 11 at 72,435,541 bp
  • A to T, chromosome 11 at 75,312,809 bp
  • A to G, chromosome 11 at 110,138,179 bp
  • A to G, chromosome 12 at 83,069,519 bp
  • A to T, chromosome 13 at 59,815,575 bp
  • A to T, chromosome 13 at 60,784,435 bp
  • A to T, chromosome 13 at 113,096,324 bp
  • T to A, chromosome 14 at 30,816,802 bp
  • C to T, chromosome 14 at 32,029,905 bp
  • A to T, chromosome 14 at 50,127,438 bp
  • T to A, chromosome 14 at 118,153,686 bp
  • G to A, chromosome 15 at 73,295,375 bp
  • T to A, chromosome 15 at 79,135,732 bp
  • T to C, chromosome 16 at 14,138,451 bp
  • T to C, chromosome 16 at 20,312,416 bp
  • T to A, chromosome 17 at 34,033,605 bp
  • T to C, chromosome 17 at 34,804,321 bp
  • C to G, chromosome 17 at 35,621,254 bp
  • C to T, chromosome 17 at 46,031,835 bp
  • G to A, chromosome 18 at 35,653,344 bp
  • T to C, chromosome 19 at 9,991,671 bp
  • T to C, chromosome 19 at 45,007,668 bp
  • CGCAGCAGCAGCAGCAGCAGC to CGCAGCAGCAGCAGCAGC, chromosome X at 138,982,677 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7798 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045648-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.