Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7798Btlr/Mmmh
Stock Number:
045648-MU
Citation ID:
RRID:MMRRC_045648-MU
Other Names:
R7798 (G1)
Major Collection:

Strain Information

Ptk2
Name: PTK2 protein tyrosine kinase 2
Synonyms: Fadk, FAK, FRNK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14083
VEGA: 15
HGNC: HGNC:9611
Homologene: 7314
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Rpa1
Name: replication protein A1
Synonyms: Rpa, RF-A, RP-A, 5031405K23Rik, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68275
Homologene: 2208
Tut7
Name: terminal uridylyl transferase 7
Synonyms: 6030448M23Rik, Tent3b, Zcchc6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 214290
VEGA: 13
Homologene: 51941
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 40,310,366 bp
  • T to C, chromosome 1 at 75,362,359 bp
  • C to A, chromosome 1 at 136,034,189 bp
  • G to A, chromosome 2 at 20,781,946 bp
  • T to C, chromosome 2 at 36,860,336 bp
  • A to T, chromosome 2 at 37,069,174 bp
  • A to T, chromosome 2 at 87,192,292 bp
  • A to G, chromosome 2 at 112,008,272 bp
  • A to C, chromosome 2 at 113,843,335 bp
  • A to C, chromosome 2 at 118,791,879 bp
  • TCTCCTC to TCTC, chromosome 2 at 121,439,456 bp
  • G to A, chromosome 2 at 178,283,910 bp
  • G to A, chromosome 3 at 34,650,642 bp
  • T to C, chromosome 3 at 40,691,929 bp
  • C to A, chromosome 3 at 64,134,097 bp
  • T to A, chromosome 3 at 144,757,962 bp
  • T to C, chromosome 3 at 144,828,130 bp
  • T to G, chromosome 4 at 116,051,174 bp
  • T to C, chromosome 4 at 123,378,100 bp
  • C to T, chromosome 4 at 140,786,439 bp
  • T to A, chromosome 4 at 155,422,622 bp
  • T to C, chromosome 5 at 16,856,658 bp
  • T to C, chromosome 5 at 52,647,189 bp
  • T to C, chromosome 5 at 87,327,723 bp
  • T to C, chromosome 5 at 90,597,511 bp
  • T to A, chromosome 5 at 123,786,294 bp
  • T to A, chromosome 5 at 123,819,117 bp
  • C to T, chromosome 5 at 140,634,783 bp
  • T to G, chromosome 5 at 144,743,770 bp
  • A to T, chromosome 6 at 70,117,371 bp
  • A to T, chromosome 6 at 116,043,578 bp
  • A to T, chromosome 6 at 127,073,214 bp
  • A to G, chromosome 6 at 146,386,015 bp
  • C to A, chromosome 7 at 45,976,853 bp
  • G to A, chromosome 7 at 46,996,056 bp
  • A to G, chromosome 7 at 74,318,596 bp
  • G to T, chromosome 7 at 84,946,322 bp
  • A to G, chromosome 7 at 84,946,984 bp
  • A to T, chromosome 7 at 107,753,948 bp
  • A to T, chromosome 7 at 118,171,939 bp
  • T to C, chromosome 7 at 141,794,041 bp
  • C to T, chromosome 8 at 33,581,847 bp
  • A to G, chromosome 9 at 21,198,663 bp
  • G to A, chromosome 9 at 30,904,643 bp
  • A to G, chromosome 9 at 44,933,331 bp
  • G to T, chromosome 9 at 64,341,017 bp
  • A to T, chromosome 10 at 61,271,173 bp
  • A to G, chromosome 10 at 86,080,253 bp
  • A to T, chromosome 10 at 86,957,912 bp
  • A to G, chromosome 11 at 5,978,399 bp
  • A to G, chromosome 11 at 9,291,664 bp
  • C to A, chromosome 11 at 29,477,348 bp
  • A to G, chromosome 11 at 48,987,332 bp
  • A to G, chromosome 11 at 50,225,670 bp
  • A to G, chromosome 11 at 67,053,802 bp
  • A to T, chromosome 11 at 72,435,541 bp
  • A to T, chromosome 11 at 75,312,809 bp
  • A to G, chromosome 11 at 110,138,179 bp
  • A to G, chromosome 12 at 83,069,519 bp
  • A to T, chromosome 13 at 59,815,575 bp
  • A to T, chromosome 13 at 60,784,435 bp
  • A to T, chromosome 13 at 113,096,324 bp
  • T to A, chromosome 14 at 30,816,802 bp
  • C to T, chromosome 14 at 32,029,905 bp
  • A to T, chromosome 14 at 50,127,438 bp
  • T to A, chromosome 14 at 118,153,686 bp
  • G to A, chromosome 15 at 73,295,375 bp
  • T to A, chromosome 15 at 79,135,732 bp
  • T to C, chromosome 16 at 14,138,451 bp
  • T to C, chromosome 16 at 20,312,416 bp
  • T to A, chromosome 17 at 34,033,605 bp
  • T to C, chromosome 17 at 34,804,321 bp
  • C to G, chromosome 17 at 35,621,254 bp
  • C to T, chromosome 17 at 46,031,835 bp
  • G to A, chromosome 18 at 35,653,344 bp
  • T to C, chromosome 19 at 9,991,671 bp
  • T to C, chromosome 19 at 45,007,668 bp
  • CGCAGCAGCAGCAGCAGCAGC to CGCAGCAGCAGCAGCAGC, chromosome X at 138,982,677 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7798 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045648-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.