Strain Name:
C57BL/6J-MtgxR7932Btlr/Mmmh
Stock Number:
045649-MU
Citation ID:
RRID:MMRRC_045649-MU
Other Names:
R7932 (G1)
Major Collection:

Strain Information

Ncam2
Name: neural cell adhesion molecule 2
Synonyms: RNCAM, R4B12 antigen, Ncam-2, Ocam
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17968
HGNC: HGNC:7657
Homologene: 3336
Itk
Name: IL2 inducible T cell kinase
Synonyms: Emt, Tsk, Tcsk
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16428
HGNC: HGNC:6171
Homologene: 4051
Ulk2
Name: unc-51 like kinase 2
Synonyms: Unc51.2, A830085I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 29869
Homologene: 5891
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Zmym1
Name: zinc finger, MYM domain containing 1
Synonyms: 5830412B09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68310
Homologene: 32904
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Igf1r
Name: insulin-like growth factor I receptor
Synonyms: CD221, IGF-1R, line 186, hyft, A330103N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16001
HGNC: HGNC:5465
Homologene: 30997
Bbx
Name: bobby sox HMG box containing
Synonyms: 5730403O13Rik, 5530401J07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70508
Homologene: 10634
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Cnn3
Name: calponin 3, acidic
Synonyms: 1600014M03Rik, Calpo3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71994
HGNC: HGNC:2157
Homologene: 37533
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Tfap2c
Name: transcription factor AP-2, gamma
Synonyms: Ap-2.2, Stra2, AP2gamma, Tcfap2c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21420
Homologene: 2423
Arhgef1
Name: Rho guanine nucleotide exchange factor 1
Synonyms: Lsc, Lbcl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16801
HGNC: HGNC:681
Homologene: 3454
Tnc
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Adam33
Name: a disintegrin and metallopeptidase domain 33
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110751
Homologene: 11881
Hk1
Name: hexokinase 1
Synonyms: Hk-1, mHk1-s, Hk1-s
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15275
HGNC: HGNC:4922
Homologene: 100530
Scfd2
Name: Sec1 family domain containing 2
Synonyms: STXBP1L1, E430013M20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 212986
Homologene: 77411
Lonrf1
Name: LON peptidase N-terminal domain and ring finger 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244421
Homologene: 34980
Slc44a3
Name: solute carrier family 44, member 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213603
Homologene: 64830
Kdm2a
Name: lysine (K)-specific demethylase 2A
Synonyms: Cxxc8, Fbl7, lalina, Jhdm1a, Fbxl11, Gm4560, 5530401A10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225876
Homologene: 56564
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Ubb
Name: ubiquitin B
Synonyms: Ubb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22187
Homologene: 74981
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Fyco1
Name: FYVE and coiled-coil domain containing 1
Synonyms: Mem2, 2810409M01Rik, ZFYVE7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17281
Homologene: 11561
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Gm19410
Name: predicted gene, 19410
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100502846
Homologene: 132117
Krt86
Name: keratin 86
Synonyms: MHb4, Krt2-11, Khb4, Krt2-10
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16679
VEGA: 15
HGNC: HGNC:6463
Homologene: 1717
Trim30a
Name: tripartite motif-containing 30A
Synonyms: Rpt-1, Rpt1, Trim30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20128
Homologene: 114426
Tshz2
Name: teashirt zinc finger family member 2
Synonyms: Mtsh2, Sdccag33l, 2900073F20Rik, Zfp218, teashirt2, Tsh2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228911
Homologene: 35258
Nsun4
Name: NOL1/NOP2/Sun domain family, member 4
Synonyms: 2310010O12Rik, 2810405F18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72181
Homologene: 12455
Sacs
Name: sacsin
Synonyms: E130115J16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50720
Fes
Name: feline sarcoma oncogene
Synonyms: c-fes
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14159
HGNC: HGNC:3657
Homologene: 37563
Cttnbp2
Name: cortactin binding protein 2
Synonyms: ORF4, Cortbp2, 9130022E09Rik, 4732477G22Rik, 3010022N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
Gadd45b
Name: growth arrest and DNA-damage-inducible 45 beta
Synonyms: Myd118
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17873
VEGA: 10
HGNC: HGNC:4096
Homologene: 7433
Slc22a23
Name: solute carrier family 22, member 23
Synonyms: 3110004L20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73102
Homologene: 41457
Blk
Name: B lymphoid kinase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12143
VEGA: 14
HGNC: HGNC:1057
Homologene: 1297
Hrh4
Name: histamine receptor H4
Synonyms: H4R
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225192
VEGA: 18
Homologene: 11002
Or2n1d
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: GA_x6K02T2PSCP-2779375-2780313, MOR256-7, Olfr136
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258803
Homologene: 119758
Adam21
Name: a disintegrin and metallopeptidase domain 21
Synonyms: ADAM31
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56622
HGNC: HGNC:200
Homologene: 68365
Timd5
Name: T cell immunoglobulin and mucin domain containing 5
Synonyms: Gm12169
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 210535
Homologene: 130033
Or1e23
Name: olfactory receptor family 1 subfamily E member 23
Synonyms: GA_x6K02T2P1NL-3676608-3675670, MOR135-14, MOR135-31_p, Olfr382
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258435
Homologene: 17252
Plscr4
Name: phospholipid scramblase 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235527
Homologene: 23217
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Or5v1b
Name: olfactory receptor family 5 subfamily V member 1B
Synonyms: MOR249-1P, GA_x6K02T2PSCP-1989071-1990024, Olfr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545205
Homologene: 73968
Ptdss1
Name: phosphatidylserine synthase 1
Synonyms: PtdSer Synthase-1, PSS-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19210
VEGA: 13
HGNC: HGNC:9587
Homologene: 7494
Fam13a
Name: family with sequence similarity 13, member A
Synonyms: D430015B01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58909
Homologene: 135847
Lrrc8d
Name: leucine rich repeat containing 8D
Synonyms: 4930525N13Rik, Lrrc5, 2810473G09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231549
Homologene: 10004
Dlgap1
Name: DLG associated protein 1
Synonyms: SAPAP1, DAP-1 beta, D17Bwg0511e, GKAP/SAPAP, Sapap1, 4933422O14Rik, Gkap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224997
HGNC: HGNC:2905
Homologene: 31258
Vmn1r237
Name: vomeronasal 1 receptor 237
Synonyms: V1rf3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171234
Homologene: 64475
Zbtb24
Name: zinc finger and BTB domain containing 24
Synonyms: ZNF450
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268294
VEGA: 10
Homologene: 8870
Arhgap24
Name: Rho GTPase activating protein 24
Synonyms: 0610025G21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231532
Homologene: 32754
Pira2
Name: paired-Ig-like receptor A2
Synonyms: 6M23
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18725
Homologene: 134028
Ptpn9
Name: protein tyrosine phosphatase, non-receptor type 9
Synonyms: Meg2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56294
VEGA: 9
HGNC: HGNC:9661
Homologene: 2121
Siae
Name: sialic acid acetylesterase
Synonyms: LSE, clone 165, Ysg2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22619
Homologene: 8001
Or5b106
Name: olfactory receptor family 5 subfamily B member 106
Synonyms: GA_x6K02T2RE5P-3473421-3472498, MOR202-17, Olfr1459
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258684
HGNC: HGNC:8324
Homologene: 115532
Or6c66
Name: olfactory receptor family 6 subfamily C member 66
Synonyms: GA_x6K02T2PULF-11304679-11303744, MOR108-1, Olfr798
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258549
Homologene: 133881
Rfpl4b
Name: ret finger protein-like 4B
Synonyms: LOC215919, Gm62, Gm3037
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215919
Homologene: 130122
Acss2
Name: acyl-CoA synthetase short-chain family member 2
Synonyms: acetyl-CoA synthetase 1, ACAS, AceCS1, Acas1, Acs1, Acas2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 60525
Homologene: 6469
Maneal
Name: mannosidase, endo-alpha-like
Synonyms: LOC215090
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 215090
Homologene: 17597
Or10z1
Name: olfactory receptor family 10 subfamily Z member 1
Synonyms: GA_x6K02T2P20D-20891507-20892448, MOR267-6, Olfr419
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258710
Homologene: 72017
Zfp689
Name: zinc finger protein 689
Synonyms: 4933416E05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71131
Homologene: 16318
Zg16
Name: zymogen granule protein 16
Synonyms: 1810010M01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69036
Homologene: 12296
Dnajc4
Name: DnaJ heat shock protein family (Hsp40) member C4
Synonyms: Mcg18, Hspf2, 2010301J22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 57431
VEGA: 19
HGNC: HGNC:5271
Homologene: 73264
Pcdhga1
Name: protocadherin gamma subfamily A, 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93709
HGNC: HGNC:8696
Homologene: 56824
Hoxa4
Name: homeobox A4
Synonyms: Hox-1.4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15401
HGNC: HGNC:5105
Homologene: 37583
Igkv16-104
Name: immunoglobulin kappa variable 16-104
Synonyms: LOC381778
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381778
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 136,084,359 bp
  • T to C, chromosome 1 at 174,250,694 bp
  • T to G, chromosome 2 at 69,426,027 bp
  • T to G, chromosome 2 at 76,725,186 bp
  • G to A, chromosome 2 at 131,063,697 bp
  • A to G, chromosome 2 at 155,573,180 bp
  • T to A, chromosome 2 at 169,886,331 bp
  • A to G, chromosome 2 at 172,551,786 bp
  • A to G, chromosome 3 at 63,701,981 bp
  • T to A, chromosome 3 at 121,451,429 bp
  • A to T, chromosome 3 at 121,512,360 bp
  • T to C, chromosome 4 at 64,008,620 bp
  • A to T, chromosome 4 at 116,044,800 bp
  • T to C, chromosome 4 at 124,861,845 bp
  • T to G, chromosome 4 at 127,050,785 bp
  • A to T, chromosome 5 at 74,531,550 bp
  • A to T, chromosome 5 at 102,845,969 bp
  • C to T, chromosome 5 at 105,813,025 bp
  • G to A, chromosome 5 at 122,644,182 bp
  • T to A, chromosome 6 at 18,427,533 bp
  • T to G, chromosome 6 at 52,190,417 bp
  • C to T, chromosome 6 at 58,983,888 bp
  • A to T, chromosome 6 at 68,425,794 bp
  • A to T, chromosome 7 at 3,842,436 bp
  • C to T, chromosome 7 at 24,919,710 bp
  • A to T, chromosome 7 at 68,212,054 bp
  • T to C, chromosome 7 at 80,379,872 bp
  • A to T, chromosome 7 at 104,429,338 bp
  • A to G, chromosome 7 at 127,050,405 bp
  • C to A, chromosome 7 at 127,444,351 bp
  • T to A, chromosome 8 at 35,795,599 bp
  • T to C, chromosome 8 at 36,222,916 bp
  • A to G, chromosome 9 at 37,633,684 bp
  • C to A, chromosome 9 at 57,036,616 bp
  • C to T, chromosome 9 at 92,490,790 bp
  • A to C, chromosome 9 at 123,828,990 bp
  • A to G, chromosome 10 at 38,821,350 bp
  • A to G, chromosome 10 at 41,451,508 bp
  • A to G, chromosome 10 at 62,315,520 bp
  • A to G, chromosome 10 at 74,645,527 bp
  • T to A, chromosome 10 at 80,930,335 bp
  • C to A, chromosome 10 at 129,625,225 bp
  • T to C, chromosome 11 at 34,267,998 bp
  • A to T, chromosome 11 at 46,340,692 bp
  • C to A, chromosome 11 at 46,535,539 bp
  • A to G, chromosome 11 at 61,808,090 bp
  • C to T, chromosome 11 at 62,552,785 bp
  • G to A, chromosome 11 at 67,294,604 bp
  • A to C, chromosome 11 at 73,517,157 bp
  • A to G, chromosome 11 at 75,492,597 bp
  • T to C, chromosome 11 at 101,540,017 bp
  • T to A, chromosome 12 at 81,560,164 bp
  • C to A, chromosome 13 at 34,182,977 bp
  • T to C, chromosome 13 at 66,966,432 bp
  • C to A, chromosome 14 at 61,204,878 bp
  • C to T, chromosome 14 at 63,373,559 bp
  • A to T, chromosome 15 at 101,476,592 bp
  • A to T, chromosome 16 at 50,210,443 bp
  • T to G, chromosome 16 at 81,615,820 bp
  • C to A, chromosome 17 at 21,314,463 bp
  • T to A, chromosome 17 at 23,818,527 bp
  • TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT to TCCTGAGGCAGTGCTGGAT, chromosome 17 at 35,622,633 bp
  • T to C, chromosome 17 at 37,530,184 bp
  • A to T, chromosome 17 at 38,335,255 bp
  • A to T, chromosome 17 at 70,516,238 bp
  • T to A, chromosome 18 at 13,015,812 bp
  • T to C, chromosome 18 at 37,663,460 bp
  • C to T, chromosome 18 at 58,020,483 bp
  • A to G, chromosome 19 at 4,319,156 bp
  • A to G, chromosome 19 at 6,988,270 bp
  • A to T, chromosome 19 at 13,145,981 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7932 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045649-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.