MMRRC:045649-MU

T to G, chromosome 1 at 136,084,359 bp
T to C, chromosome 1 at 174,250,694 bp
T to G, chromosome 2 at 69,426,027 bp
T to G, chromosome 2 at 76,725,186 bp
G to A, chromosome 2 at 131,063,697 bp
A to G, chromosome 2 at 155,573,180 bp
T to A, chromosome 2 at 169,886,331 bp
A to G, chromosome 2 at 172,551,786 bp
A to G, chromosome 3 at 63,701,981 bp
T to A, chromosome 3 at 121,451,429 bp
A to T, chromosome 3 at 121,512,360 bp
T to C, chromosome 4 at 64,008,620 bp
A to T, chromosome 4 at 116,044,800 bp
T to C, chromosome 4 at 124,861,845 bp
T to G, chromosome 4 at 127,050,785 bp
A to T, chromosome 5 at 74,531,550 bp
A to T, chromosome 5 at 102,845,969 bp
C to T, chromosome 5 at 105,813,025 bp
G to A, chromosome 5 at 122,644,182 bp
T to A, chromosome 6 at 18,427,533 bp
T to G, chromosome 6 at 52,190,417 bp
C to T, chromosome 6 at 58,983,888 bp
A to T, chromosome 6 at 68,425,794 bp
A to T, chromosome 7 at 3,842,436 bp
C to T, chromosome 7 at 24,919,710 bp
A to T, chromosome 7 at 68,212,054 bp
T to C, chromosome 7 at 80,379,872 bp
A to T, chromosome 7 at 104,429,338 bp
A to G, chromosome 7 at 127,050,405 bp
C to A, chromosome 7 at 127,444,351 bp
T to A, chromosome 8 at 35,795,599 bp
T to C, chromosome 8 at 36,222,916 bp
A to G, chromosome 9 at 37,633,684 bp
C to A, chromosome 9 at 57,036,616 bp
C to T, chromosome 9 at 92,490,790 bp
A to C, chromosome 9 at 123,828,990 bp
A to G, chromosome 10 at 38,821,350 bp
A to G, chromosome 10 at 41,451,508 bp
A to G, chromosome 10 at 62,315,520 bp
A to G, chromosome 10 at 74,645,527 bp
T to A, chromosome 10 at 80,930,335 bp
C to A, chromosome 10 at 129,625,225 bp
T to C, chromosome 11 at 34,267,998 bp
A to T, chromosome 11 at 46,340,692 bp
C to A, chromosome 11 at 46,535,539 bp
A to G, chromosome 11 at 61,808,090 bp
C to T, chromosome 11 at 62,552,785 bp
G to A, chromosome 11 at 67,294,604 bp
A to C, chromosome 11 at 73,517,157 bp
A to G, chromosome 11 at 75,492,597 bp
T to C, chromosome 11 at 101,540,017 bp
T to A, chromosome 12 at 81,560,164 bp
C to A, chromosome 13 at 34,182,977 bp
T to C, chromosome 13 at 66,966,432 bp
C to A, chromosome 14 at 61,204,878 bp
C to T, chromosome 14 at 63,373,559 bp
A to T, chromosome 15 at 101,476,592 bp
A to T, chromosome 16 at 50,210,443 bp
T to G, chromosome 16 at 81,615,820 bp
C to A, chromosome 17 at 21,314,463 bp
T to A, chromosome 17 at 23,818,527 bp
TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT to TCCTGAGGCAGTGCTGGAT, chromosome 17 at 35,622,633 bp
T to C, chromosome 17 at 37,530,184 bp
A to T, chromosome 17 at 38,335,255 bp
A to T, chromosome 17 at 70,516,238 bp
T to A, chromosome 18 at 13,015,812 bp
T to C, chromosome 18 at 37,663,460 bp
C to T, chromosome 18 at 58,020,483 bp
A to G, chromosome 19 at 4,319,156 bp
A to G, chromosome 19 at 6,988,270 bp
A to T, chromosome 19 at 13,145,981 bp

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R7932 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
045649-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All