Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7590Btlr/Mmmh
Stock Number:
045669-MU
Citation ID:
RRID:MMRRC_045669-MU
Other Names:
R7590 (G1)
Major Collection:

Strain Information

Gdi2
Name: GDP dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Usp1
Name: ubiquitin specific peptidase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230484
Homologene: 2528
Ireb2
Name: iron responsive element binding protein 2
Synonyms: Irp2, D9Ertd85e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64602
VEGA: 9
HGNC: HGNC:6115
Homologene: 11280
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Itprid2
Name: ITPR interacting domain containing 2
Synonyms: SPAG13, CS-1, CS1, KRAP, Ssfa2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70599
Homologene: 4912
Fip1l1
Name: factor interacting with PAPOLA and CPSF1
Synonyms: Rje, 1300019H17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66899
Homologene: 136254
Ssb
Name: small RNA binding exonuclease protection factor La
Synonyms: La protein, SS-B, autoantigen La, Sjogren syndrome antigen B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20823
Homologene: 2366
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 126,026,533 bp
  • T to A, chromosome 1 at 162,859,682 bp
  • A to G, chromosome 1 at 181,821,511 bp
  • A to G, chromosome 2 at 25,195,798 bp
  • A to T, chromosome 2 at 52,243,842 bp
  • G to A, chromosome 2 at 69,867,290 bp
  • G to T, chromosome 2 at 79,658,110 bp
  • A to T, chromosome 2 at 110,268,232 bp
  • G to A, chromosome 3 at 86,114,906 bp
  • A to C, chromosome 4 at 48,467,725 bp
  • A to G, chromosome 4 at 98,934,252 bp
  • A to G, chromosome 4 at 104,945,246 bp
  • T to A, chromosome 4 at 128,748,027 bp
  • A to T, chromosome 4 at 151,991,775 bp
  • G to T, chromosome 5 at 26,085,766 bp
  • T to C, chromosome 5 at 74,591,774 bp
  • A to T, chromosome 5 at 86,239,473 bp
  • T to A, chromosome 5 at 151,561,729 bp
  • T to A, chromosome 6 at 35,279,463 bp
  • T to A, chromosome 6 at 124,632,128 bp
  • T to C, chromosome 7 at 104,579,942 bp
  • A to T, chromosome 7 at 108,317,179 bp
  • A to G, chromosome 8 at 15,117,679 bp
  • T to C, chromosome 8 at 117,080,786 bp
  • T to A, chromosome 9 at 5,306,710 bp
  • G to A, chromosome 9 at 43,311,491 bp
  • T to A, chromosome 9 at 54,896,495 bp
  • G to A, chromosome 9 at 64,888,587 bp
  • A to T, chromosome 9 at 77,230,043 bp
  • A to T, chromosome 9 at 107,791,750 bp
  • A to C, chromosome 9 at 114,562,825 bp
  • A to G, chromosome 9 at 119,666,400 bp
  • A to G, chromosome 10 at 88,480,826 bp
  • T to C, chromosome 11 at 58,567,259 bp
  • T to A, chromosome 11 at 109,938,515 bp
  • T to C, chromosome 11 at 116,205,640 bp
  • T to A, chromosome 12 at 108,003,143 bp
  • A to G, chromosome 13 at 3,564,611 bp
  • A to G, chromosome 13 at 14,264,083 bp
  • T to C, chromosome 13 at 75,770,735 bp
  • T to C, chromosome 13 at 75,977,652 bp
  • T to C, chromosome 13 at 100,219,696 bp
  • G to T, chromosome 13 at 100,219,697 bp
  • GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC to GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC, chromosome 14 at 14,119,882 bp
  • A to G, chromosome 14 at 15,006,693 bp
  • A to G, chromosome 15 at 67,111,346 bp
  • A to T, chromosome 16 at 32,052,196 bp
  • G to A, chromosome 17 at 44,085,264 bp
  • A to T, chromosome 17 at 46,298,683 bp
  • T to A, chromosome 18 at 77,321,634 bp
  • C to G, chromosome 19 at 18,832,581 bp
  • T to C, chromosome 19 at 24,709,265 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7590 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045669-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.