Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7590Btlr/Mmmh
Stock Number:
045669-MU
Citation ID:
RRID:MMRRC_045669-MU
Other Names:
R7590 (G1)
Major Collection:

Strain Information

Gdi2
Name: GDP dissociation inhibitor 2
Synonyms: GDI beta, GDI-B, GDIB, Gdi3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14569
VEGA: 13
HGNC: HGNC:4227
Homologene: 37488
Usp1
Name: ubiquitin specific peptidase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230484
Homologene: 2528
Ireb2
Name: iron responsive element binding protein 2
Synonyms: Irp2, D9Ertd85e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64602
VEGA: 9
HGNC: HGNC:6115
Homologene: 11280
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Itprid2
Name: ITPR interacting domain containing 2
Synonyms: SPAG13, CS-1, CS1, KRAP, Ssfa2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70599
Homologene: 4912
Fip1l1
Name: factor interacting with PAPOLA and CPSF1
Synonyms: Rje, 1300019H17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66899
Homologene: 136254
Ssb
Name: small RNA binding exonuclease protection factor La
Synonyms: La protein, SS-B, autoantigen La, Sjogren syndrome antigen B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20823
Homologene: 2366
Sh3d19
Name: SH3 domain protein D19
Synonyms: Kryn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27059
Homologene: 19064
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Trim71
Name: tripartite motif-containing 71
Synonyms: LOC382112, lin-41, mlin-41, Lin41, 2610206G21Rik, 636931, mLin41
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 636931
Homologene: 9076
Enpp5
Name: ectonucleotide pyrophosphatase/phosphodiesterase 5
Synonyms: D17Abb1e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83965
Homologene: 23313
Lbr
Name: lamin B receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98386
HGNC: HGNC:6518
Homologene: 2455
Phf13
Name: PHD finger protein 13
Synonyms: SPOC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230936
Homologene: 17822
Pak2
Name: p21 (RAC1) activated kinase 2
Synonyms: PAK-2, D16Ertd269e, A130002K10Rik, 5330420P17Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224105
HGNC: HGNC:8591
Homologene: 99711
St3gal1
Name: ST3 beta-galactoside alpha-2,3-sialyltransferase 1
Synonyms: CMP-N-acetylneuraminate: [beta-galactosidase alpha-2,3] sialytransferase, Siat4, ST3GalI, Siat4a
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20442
VEGA: 15
Homologene: 7540
Ell2
Name: elongation factor for RNA polymerase II 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 192657
VEGA: 13
Homologene: 8094
Trim29
Name: tripartite motif-containing 29
Synonyms: 2810431N19Rik, 4732461M22Rik, 1110047J21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72169
VEGA: 9
Homologene: 8100
Casp1
Name: caspase 1
Synonyms: ICE, Caspase-1, interleukin 1 beta-converting enzyme, Il1bc
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12362
VEGA: 9
HGNC: HGNC:1499
Homologene: 133272
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 674895
Homologene: 130947
Trpm6
Name: transient receptor potential cation channel, subfamily M, member 6
Synonyms: CHAK2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225997
VEGA: 19
Homologene: 9767
Pgm5
Name: phosphoglucomutase 5
Synonyms: 9530034F03Rik, aciculin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226041
HGNC: HGNC:8908
Homologene: 74881
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240411
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Bbox1
Name: gamma-butyrobetaine hydroxylase 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170442
HGNC: HGNC:964
Homologene: 2967
Slc13a4
Name: solute carrier family 13 (sodium/sulfate symporters), member 4
Synonyms: SUT-1, SUT1, 9630060C05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243755
Homologene: 69125
Bcl11b
Name: B cell leukemia/lymphoma 11B
Synonyms: COUP-TF interacting protein 2, CTIP2, B630002E05Rik, Rit1, 9130430L19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 58208
Homologene: 10974
Abca8b
Name: ATP-binding cassette, sub-family A member 8b
Synonyms: Abca8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Fyb2
Name: FYN binding protein 2
Synonyms: 1700024P16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242594
Homologene: 52981
Vmn2r18
Name: vomeronasal 2, receptor 18
Synonyms: EG632671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 632671
Tex10
Name: testis expressed gene 10
Synonyms: clone 18330, 2810462N03Rik, 2610206N19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269536
Homologene: 32361
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Dlk2
Name: delta like non-canonical Notch ligand 2
Synonyms: Egfl9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106565
Homologene: 11397
Or5p1
Name: olfactory receptor family 5 subfamily P member 1
Synonyms: GA_x6K02T2PBJ9-10646917-10647849, MOR204-11, Olfr491
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258731
Homologene: 128150
Tmprss11c
Name: transmembrane protease, serine 11c
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435845
Homologene: 78847
Fmo1
Name: flavin containing monooxygenase 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14261
HGNC: HGNC:3769
Homologene: 55520
Or52d3
Name: olfactory receptor family 52 subfamily D member 3
Synonyms: GA_x6K02T2PBJ9-7206970-7207923, MOR33-1, Olfr653
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57250
Homologene: 115518
Mlip
Name: muscular LMNA-interacting protein
Synonyms: 2310046A06Rik, cardiac ISL1-interacting protein, CIP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69642
Homologene: 90445
Spata9
Name: spermatogenesis associated 9
Synonyms: 4930599C08Rik, 1700030K01Rik, A930023H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75571
VEGA: 13
Homologene: 12609
Phc2
Name: polyhomeotic 2
Synonyms: Mph2, D4Ertd810e, Edr2, D130050K19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54383
HGNC: HGNC:3183
Homologene: 75090
Hecw1
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Synonyms: NEDL1, E130207I19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94253
VEGA: 13
Homologene: 9004
C1s2
Name: complement component 1, s subcomponent 2
Synonyms: Gm5077
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 317677
HGNC: HGNC:1247
Homologene: 1314
Chpt1
Name: choline phosphotransferase 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212862
Homologene: 69297
Speer4a2
Name: spermatogenesis associated glutamate (E)-rich protein 4A2
Synonyms: Gm10471
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100039045
Homologene: 69402
Psmd6
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 6
Synonyms: 2400006A19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66413
HGNC: HGNC:9564
Homologene: 7157
Tor4a
Name: torsin family 4, member A
Synonyms: A830007P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227612
Homologene: 17140
Or2t43
Name: olfactory receptor family 2 subfamily T member 43
Synonyms: GA_x6K02T2NKPP-858022-858862, GA_x6K02T00261-652-347, MOR275-3, MOR275-10_p, Olfr327-ps1, Olfr224
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258198
Homologene: 133015
Ten1
Name: TEN1 telomerase capping complex subunit
Synonyms: 2310004N24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69535
Homologene: 28494
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 126,026,533 bp
  • T to A, chromosome 1 at 162,859,682 bp
  • A to G, chromosome 1 at 181,821,511 bp
  • A to G, chromosome 2 at 25,195,798 bp
  • A to T, chromosome 2 at 52,243,842 bp
  • G to A, chromosome 2 at 69,867,290 bp
  • G to T, chromosome 2 at 79,658,110 bp
  • A to T, chromosome 2 at 110,268,232 bp
  • G to A, chromosome 3 at 86,114,906 bp
  • A to C, chromosome 4 at 48,467,725 bp
  • A to G, chromosome 4 at 98,934,252 bp
  • A to G, chromosome 4 at 104,945,246 bp
  • T to A, chromosome 4 at 128,748,027 bp
  • A to T, chromosome 4 at 151,991,775 bp
  • G to T, chromosome 5 at 26,085,766 bp
  • T to C, chromosome 5 at 74,591,774 bp
  • A to T, chromosome 5 at 86,239,473 bp
  • T to A, chromosome 5 at 151,561,729 bp
  • T to A, chromosome 6 at 35,279,463 bp
  • T to A, chromosome 6 at 124,632,128 bp
  • T to C, chromosome 7 at 104,579,942 bp
  • A to T, chromosome 7 at 108,317,179 bp
  • A to G, chromosome 8 at 15,117,679 bp
  • T to C, chromosome 8 at 117,080,786 bp
  • T to A, chromosome 9 at 5,306,710 bp
  • G to A, chromosome 9 at 43,311,491 bp
  • T to A, chromosome 9 at 54,896,495 bp
  • G to A, chromosome 9 at 64,888,587 bp
  • A to T, chromosome 9 at 77,230,043 bp
  • A to T, chromosome 9 at 107,791,750 bp
  • A to C, chromosome 9 at 114,562,825 bp
  • A to G, chromosome 9 at 119,666,400 bp
  • A to G, chromosome 10 at 88,480,826 bp
  • T to C, chromosome 11 at 58,567,259 bp
  • T to A, chromosome 11 at 109,938,515 bp
  • T to C, chromosome 11 at 116,205,640 bp
  • T to A, chromosome 12 at 108,003,143 bp
  • A to G, chromosome 13 at 3,564,611 bp
  • A to G, chromosome 13 at 14,264,083 bp
  • T to C, chromosome 13 at 75,770,735 bp
  • T to C, chromosome 13 at 75,977,652 bp
  • T to C, chromosome 13 at 100,219,696 bp
  • G to T, chromosome 13 at 100,219,697 bp
  • GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC to GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC, chromosome 14 at 14,119,882 bp
  • A to G, chromosome 14 at 15,006,693 bp
  • A to G, chromosome 15 at 67,111,346 bp
  • A to T, chromosome 16 at 32,052,196 bp
  • G to A, chromosome 17 at 44,085,264 bp
  • A to T, chromosome 17 at 46,298,683 bp
  • T to A, chromosome 18 at 77,321,634 bp
  • C to G, chromosome 19 at 18,832,581 bp
  • T to C, chromosome 19 at 24,709,265 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7590 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045669-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.