Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7637Btlr/Mmmh
Stock Number:
045695-MU
Citation ID:
RRID:MMRRC_045695-MU
Other Names:
R7637 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Nlk
Name: nemo like kinase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18099
Homologene: 88836
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Grhl2
Name: grainyhead like transcription factor 2
Synonyms: BOM, 0610015A08Rik, Tcfcp2l3, grainyheadlike, clft3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 252973
HGNC: HGNC:2799
Homologene: 32616
Taf3
Name: TATA-box binding protein associated factor 3
Synonyms: mTAFII140, 4933439M23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209361
Homologene: 35415
Pds5a
Name: PDS5 cohesin associated factor A
Synonyms: E230024D05Rik, 9030416H16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71521
Homologene: 22877
Tpr
Name: translocated promoter region, nuclear basket protein
Synonyms: 2610029M07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108989
Homologene: 37753
Sart3
Name: squamous cell carcinoma antigen recognized by T cells 3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53890
Homologene: 40977
Tppp3
Name: tubulin polymerization-promoting protein family member 3
Synonyms: 2700055K07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67971
Homologene: 32659
Ndufb6
Name: NADH:ubiquinone oxidoreductase subunit B6
Synonyms: LOC230075
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230075
HGNC: HGNC:7701
Homologene: 1864
Adam8
Name: a disintegrin and metallopeptidase domain 8
Synonyms: CD156, MS2, E430039A18Rik, CD156a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11501
HGNC: HGNC:215
Homologene: 74384
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NMDAR2C, NR2C, GluRepsilon3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14813
HGNC: HGNC:4587
Homologene: 647
Zfp335
Name: zinc finger protein 335
Synonyms: 1810045J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329559
Homologene: 11129
Hspa9
Name: heat shock protein 9
Synonyms: mortalin, Hsp74a, Hsp74, Hsc74, PBP74, GRP75, mthsp70, mot-2, Hspa9a, C3H-specific antigen, CSA
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15526
HGNC: HGNC:5244
Homologene: 39452
Scpep1
Name: serine carboxypeptidase 1
Synonyms: 2410018F01Rik, Risc, 4833411K15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74617
Homologene: 41443
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230676
Homologene: 49413
Tsc2
Name: TSC complex subunit 2
Synonyms: tuberin, Nafld, tuberous sclerosis 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22084
VEGA: 17
Homologene: 462
Itgae
Name: integrin alpha E, epithelial-associated
Synonyms: CD103, alpha-E1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16407
HGNC: HGNC:6147
Homologene: 113560
Sirpa
Name: signal-regulatory protein alpha
Synonyms: SIRP, P84, SHPS-1, Bit, CD172a, Idd13.2, Ptpns1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19261
HGNC: HGNC:9662
Homologene: 7246
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Ppfia2
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Synonyms: E130120L08Rik, Liprin-alpha2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327814
VEGA: 10
HGNC: HGNC:9246
Homologene: 27953
Tmem132e
Name: transmembrane protein 132E
Synonyms: LOC270893
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 270893
Homologene: 41524
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Tie1
Name: tyrosine kinase with immunoglobulin-like and EGF-like domains 1
Synonyms: TIE, D430008P04Rik, tie-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21846
Homologene: 3957
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Pygl
Name: liver glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110095
HGNC: HGNC:9725
Homologene: 84371
Plekhh3
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217198
Homologene: 11787
Or5i1
Name: olfactory receptor family 5 subfamily I member 1
Synonyms: V1, Olfr4-1, MOR181-1, GA_x6K02T2Q125-49283184-49284128, Olfr152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258640
HGNC: HGNC:8347
Homologene: 4835
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: 1200011I03Rik, Mamdc3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74762
Homologene: 17780
Tmx3
Name: thioredoxin-related transmembrane protein 3
Synonyms: 6430411B10Rik, A730024F05Rik, Txndc10
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67988
VEGA: 18
Homologene: 10381
Pdlim3
Name: PDZ and LIM domain 3
Synonyms: ALP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 53318
Homologene: 75063
Wnt10a
Name: wingless-type MMTV integration site family, member 10A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22409
Homologene: 22525
Gm57858
Name: gene model 57858
Synonyms: Ccdc144b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241943
Homologene: 87263
Pank1
Name: pantothenate kinase 1
Synonyms: 5430426F23Rik, Pank1b, Pank1a, Pank1, 4632412I06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 75735
VEGA: 19
HGNC: HGNC:8598
Homologene: 56979
Prss23
Name: serine protease 23
Synonyms: 2310046G15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76453
Homologene: 5191
Selenbp1
Name: selenium binding protein 1
Synonyms: Lp56, Lpsb
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20341
Homologene: 2930
Fars2
Name: phenylalanine-tRNA synthetase 2, mitochondrial
Synonyms: 2810431B21Rik, 6720478K01Rik, Fars1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69955
VEGA: 13
Homologene: 4788
Vmn1r199
Name: vomeronasal 1 receptor 199
Synonyms: V1rh4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171247
Homologene: 110880
Gnat3
Name: G protein subunit alpha transducin 3
Synonyms: Ggust, Gtn, alpha-gustducin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242851
Homologene: 24284
Qsox2
Name: quiescin Q6 sulfhydryl oxidase 2
Synonyms: QSOX2, Qscn6l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227638
Homologene: 65608
Fam8a1
Name: family with sequence similarity 8, member A1
Synonyms: C78339
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97863
Homologene: 32301
Prl3d1
Name: prolactin family 3, subfamily d, member 1
Synonyms: Pl-1, Pl1, prolactin-like 2, PL-Ia, Csh1, mPL-I, placental lactogen 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18775
Homologene: 137215
Hipk4
Name: homeodomain interacting protein kinase 4
Synonyms: LOC233020
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233020
Homologene: 16970
Sowahc
Name: sosondowah ankyrin repeat domain family member C
Synonyms: C820004L04Rik, Ankrd57
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268301
Homologene: 49723
Litafd
Name: LITAF domain containing
Synonyms: Gm43786, Gm5767
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 436336
Homologene: 80030
Igkv12-89
Name: immunoglobulin kappa chain variable 12-89
Synonyms: Gm16905
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 384411
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 66,672,684 bp
  • T to A, chromosome 1 at 74,793,474 bp
  • T to C, chromosome 1 at 150,423,516 bp
  • A to G, chromosome 2 at 9,940,993 bp
  • A to T, chromosome 2 at 12,109,187 bp
  • A to G, chromosome 2 at 26,221,020 bp
  • A to T, chromosome 2 at 87,783,434 bp
  • A to G, chromosome 2 at 129,616,445 bp
  • A to G, chromosome 2 at 164,892,539 bp
  • T to A, chromosome 3 at 36,046,876 bp
  • C to A, chromosome 3 at 94,937,348 bp
  • T to A, chromosome 3 at 98,146,623 bp
  • T to C, chromosome 3 at 104,795,885 bp
  • A to T, chromosome 4 at 40,273,080 bp
  • T to C, chromosome 4 at 118,393,828 bp
  • T to C, chromosome 4 at 118,472,978 bp
  • A to G, chromosome 5 at 18,003,772 bp
  • T to C, chromosome 5 at 25,315,095 bp
  • C to A, chromosome 5 at 65,638,604 bp
  • T to C, chromosome 5 at 113,771,352 bp
  • A to G, chromosome 6 at 68,835,099 bp
  • A to G, chromosome 7 at 27,523,548 bp
  • T to A, chromosome 7 at 89,510,246 bp
  • C to T, chromosome 7 at 139,985,430 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • T to C, chromosome 8 at 45,909,065 bp
  • A to G, chromosome 8 at 105,468,292 bp
  • A to C, chromosome 9 at 111,365,296 bp
  • G to A, chromosome 10 at 59,222,183 bp
  • T to C, chromosome 10 at 106,865,403 bp
  • A to T, chromosome 11 at 73,113,631 bp
  • T to C, chromosome 11 at 78,591,005 bp
  • T to A, chromosome 11 at 82,434,516 bp
  • T to C, chromosome 11 at 86,730,332 bp
  • A to G, chromosome 11 at 88,929,220 bp
  • T to C, chromosome 11 at 101,164,327 bp
  • T to A, chromosome 11 at 110,218,952 bp
  • A to T, chromosome 11 at 115,256,259 bp
  • C to T, chromosome 12 at 70,197,795 bp
  • G to T, chromosome 13 at 22,382,675 bp
  • A to G, chromosome 13 at 27,100,069 bp
  • G to T, chromosome 13 at 36,204,775 bp
  • A to T, chromosome 13 at 46,671,247 bp
  • T to C, chromosome 13 at 93,083,212 bp
  • G to A, chromosome 14 at 67,786,340 bp
  • A to C, chromosome 15 at 37,328,330 bp
  • C to T, chromosome 16 at 8,683,646 bp
  • G to A, chromosome 17 at 24,607,492 bp
  • C to T, chromosome 17 at 29,832,379 bp
  • G to T, chromosome 18 at 34,938,687 bp
  • A to G, chromosome 18 at 90,537,109 bp
  • A to T, chromosome 19 at 16,750,149 bp
  • A to C, chromosome 19 at 34,821,988 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7637 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045695-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.