Strain Name:
C57BL/6J-MtgxR7643Btlr/Mmmh
Stock Number:
045700-MU
Citation ID:
RRID:MMRRC_045700-MU
Other Names:
R7643 (G1)
Major Collection:

Strain Information

Marchf4
Name: membrane associated ring-CH-type finger 4
Synonyms: March4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381270
Homologene: 66199
Gon4l
Name: gon-4 like
Synonyms: 1500041I23Rik, 2610100B20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76022
Homologene: 13002
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, 4921505C17Rik, D530039E11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: p53BP1, 53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Gluralpha4, Glur4, Glur-4, spkw1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, Phr1, C130061D10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Nup93
Name: nucleoporin 93
Synonyms: 2410008G02Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71805
Homologene: 40971
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Cep290
Name: centrosomal protein 290
Synonyms: b2b1752Clo, Kiaa, b2b1454Clo, Nphp6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Zfp106
Name: zinc finger protein 106
Synonyms: sirm, Sh3bp3, H3a, Cd-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Gabpb2
Name: GA repeat binding protein, beta 2
Synonyms: 9430006E19Rik, A430024B14Rik, 1810015F01Rik, Gabpb2-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213054
Homologene: 34921
Irak4
Name: interleukin-1 receptor-associated kinase 4
Synonyms: 9330209D03Rik, 8430405M07Rik, IRAK-4, NY-REN-64
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 266632
Homologene: 41109
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: DR6, TR7, Death receptor 6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: LOC327983, acetyl-CoA carboxylase, Acac, A530025K05Rik, Acc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Emc7
Name: ER membrane protein complex subunit 7
Synonyms: 2900064A13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 73024
Homologene: 10597
Klf5
Name: Kruppel-like transcription factor 5
Synonyms: 4930520J07Rik, IKLF, Bteb2, CKLF
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12224
VEGA: 14
HGNC: HGNC:6349
Homologene: 37520
Med23
Name: mediator complex subunit 23
Synonyms: sno, ESTM7, Sur2, X83317, Crsp3, 3000002A17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Ing5
Name: inhibitor of growth family, member 5
Synonyms: 1810018M11Rik, 1700027H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66262
Homologene: 90955
Qser1
Name: glutamine and serine rich 1
Synonyms: 4732486I23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99003
Homologene: 11710
Zfp599
Name: zinc finger protein 599
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235048
Homologene: 138456
Spink5
Name: serine peptidase inhibitor, Kazal type 5
Synonyms: LEKT1, 2310065D10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72432
Homologene: 4987
4931406C07Rik
Name: RIKEN cDNA 4931406C07 gene
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70984
VEGA: 9
Homologene: 8531
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Ttn
Name: titin
Synonyms: 2310074I15Rik, D330041I19Rik, 2310057K23Rik, connectin, 2310036G12Rik, shru, D830007G01Rik, L56, 1100001C23Rik, mdm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Unc13b
Name: unc-13 homolog B
Synonyms: Munc13-2, Unc13h2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Nlgn2
Name: neuroligin 2
Synonyms: NLG2, NL2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216856
Homologene: 69317
Uckl1
Name: uridine-cytidine kinase 1-like 1
Synonyms: 1110007H10Rik, Urkl1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68556
Homologene: 101414
Plb1
Name: phospholipase B1
Synonyms: 4930539A06Rik, 4632413E21Rik, 4930433E17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665270
Homologene: 82108
Lrp2bp
Name: Lrp2 binding protein
Synonyms: 4930479L12Rik, MegBP, 1700113N17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67620
Homologene: 10183
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Zcchc4
Name: zinc finger, CCHC domain containing 4
Synonyms: 4930449I23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78796
Homologene: 14632
Acrbp
Name: proacrosin binding protein
Synonyms: sp32, OY-TES-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54137
Homologene: 9641
Tdrd1
Name: tudor domain containing 1
Synonyms: MTR-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83561
Homologene: 12850
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268527
Homologene: 8780
Pde6c
Name: phosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonyms: cpfl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 110855
VEGA: 19
HGNC: HGNC:8787
Homologene: 4521
Bst1
Name: bone marrow stromal cell antigen 1
Synonyms: Bp3, 114/A10, Bsta1, CD157, Ly65
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12182
HGNC: HGNC:1118
Homologene: 3198
Amn1
Name: antagonist of mitotic exit network 1
Synonyms: C730024G19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232566
Homologene: 45811
Adcy6
Name: adenylate cyclase 6
Synonyms: AC6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11512
VEGA: 15
HGNC: HGNC:237
Homologene: 22400
Or51e1
Name: olfactory receptor family 51 subfamily E member 1
Synonyms: GA_x6K02T2PBJ9-5425951-5426904, MOR18-1, Olfr558
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259097
Homologene: 17503
Tex55
Name: testis expressed 55
Synonyms: 4930435E12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74663
Homologene: 17614
Fam83c
Name: family with sequence similarity 83, member C
Synonyms: 5530400B04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71405
Homologene: 18669
Megf11
Name: multiple EGF-like-domains 11
Synonyms: 2410080H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214058
Homologene: 13031
Zscan4e
Name: zinc finger and SCAN domain containing 4E
Synonyms: EG665848
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665848
Homologene: 85986
Rbm12
Name: RNA binding motif protein 12
Synonyms: 9430070C08Rik, SWAN, 5730420G12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75710
HGNC: HGNC:9898
Homologene: 34993
Ankrd13b
Name: ankyrin repeat domain 13b
Synonyms: B930093C12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268445
Homologene: 27367
Gbp2b
Name: guanylate binding protein 2b
Synonyms: LIMIT, Mpa-1, Gbp1, Mag-1, Gbp-1, Mpa1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14468
Homologene: 137233
Spon2
Name: spondin 2, extracellular matrix protein
Synonyms: 2310045I24Rik, M-spondin, Mindin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100689
Homologene: 40843
Exoc3l4
Name: exocyst complex component 3-like 4
Synonyms: 1200009I06Rik, 1600013K19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74190
VEGA: 12
Homologene: 41760
Ccdc7a
Name: coiled-coil domain containing 7A
Synonyms: Ccdc7, 4930517G15Rik, 4930540C21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74703
Homologene: 134760
Itga7
Name: integrin alpha 7
Synonyms: alpha7, [a]7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16404
VEGA: 10
HGNC: HGNC:6143
Homologene: 37592
Or14a257
Name: olfactory receptor family 14 subfamily A member 257
Synonyms: MOR219-4, Olfr298, GA_x6K02T2NHDJ-9619796-9620794
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257905
Cfhr1
Name: complement factor H-related 1
Synonyms: Cfhl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 50702
Homologene: 55632
Dnah7c
Name: dynein, axonemal, heavy chain 7C
Synonyms: Dnahc7c
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100101919
Homologene: 41287
Rpp14
Name: ribonuclease P 14 subunit
Synonyms: 2610511E03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67053
Homologene: 5113
Gpr15
Name: G protein-coupled receptor 15
Synonyms: 4933439K08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71223
VEGA: 16
HGNC: HGNC:4469
Homologene: 3869
Otop3
Name: otopetrin 3
Synonyms: 2310011E08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69602
Homologene: 26091
Krtap29-1
Name: keratin associated protein 29-1
Synonyms: Gm14195
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100462664
Hacd1
Name: 3-hydroxyacyl-CoA dehydratase 1
Synonyms: Ptpla
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30963
HGNC: HGNC:9639
Homologene: 69153
Gm19965
Name: predicted gene, 19965
Type: Gene
Species: Mouse
Chromosome: 1
Trav6-2
Name: T cell receptor alpha variable 6-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 436539
Or10d5b
Name: olfactory receptor family 10 subfamily D member 5B, pseudogene 1
Synonyms: Olfr977, GA_x6K02T2PVTD-33675353-33674411, MOR224-11
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257903
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 46,602,813 bp
  • T to G, chromosome 1 at 72,447,220 bp
  • T to A, chromosome 1 at 93,812,433 bp
  • C to G, chromosome 1 at 116,822,229 bp
  • A to G, chromosome 1 at 139,553,585 bp
  • T to C, chromosome 2 at 14,044,791 bp
  • T to C, chromosome 2 at 76,734,827 bp
  • A to T, chromosome 2 at 104,786,977 bp
  • A to G, chromosome 2 at 112,455,279 bp
  • C to T, chromosome 2 at 120,512,734 bp
  • G to T, chromosome 2 at 121,247,814 bp
  • A to G, chromosome 2 at 155,831,004 bp
  • A to T, chromosome 2 at 156,098,217 bp
  • T to C, chromosome 2 at 181,573,106 bp
  • T to A, chromosome 3 at 88,902,807 bp
  • C to A, chromosome 3 at 95,200,225 bp
  • G to T, chromosome 3 at 142,603,609 bp
  • T to A, chromosome 4 at 43,216,333 bp
  • T to C, chromosome 4 at 84,506,574 bp
  • C to T, chromosome 5 at 32,247,557 bp
  • T to A, chromosome 5 at 33,217,456 bp
  • G to A, chromosome 5 at 43,840,449 bp
  • T to C, chromosome 5 at 52,808,293 bp
  • C to T, chromosome 5 at 53,123,162 bp
  • G to A, chromosome 6 at 125,053,832 bp
  • C to T, chromosome 6 at 149,185,031 bp
  • A to T, chromosome 7 at 11,309,525 bp
  • T to C, chromosome 7 at 81,477,072 bp
  • C to T, chromosome 7 at 86,489,568 bp
  • A to T, chromosome 7 at 87,323,754 bp
  • C to T, chromosome 7 at 102,709,538 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • A to C, chromosome 8 at 33,575,120 bp
  • A to T, chromosome 8 at 46,020,527 bp
  • T to C, chromosome 8 at 94,286,619 bp
  • C to T, chromosome 8 at 128,889,811 bp
  • T to C, chromosome 9 at 4,793,950 bp
  • A to G, chromosome 9 at 15,297,860 bp
  • G to T, chromosome 9 at 22,249,892 bp
  • T to A, chromosome 9 at 39,974,821 bp
  • T to C, chromosome 9 at 64,706,632 bp
  • T to C, chromosome 9 at 110,567,840 bp
  • A to G, chromosome 10 at 24,905,965 bp
  • A to G, chromosome 10 at 100,537,553 bp
  • A to G, chromosome 10 at 128,953,501 bp
  • G to T, chromosome 11 at 69,827,885 bp
  • A to G, chromosome 11 at 77,473,085 bp
  • T to C, chromosome 11 at 84,338,356 bp
  • C to T, chromosome 11 at 99,978,198 bp
  • T to C, chromosome 11 at 115,339,648 bp
  • T to C, chromosome 12 at 16,711,996 bp
  • G to A, chromosome 12 at 111,421,935 bp
  • C to A, chromosome 14 at 8,090,325 bp
  • T to A, chromosome 14 at 52,667,442 bp
  • A to G, chromosome 14 at 99,313,178 bp
  • G to T, chromosome 14 at 103,346,265 bp
  • T to A, chromosome 15 at 6,769,269 bp
  • T to A, chromosome 15 at 94,558,828 bp
  • T to A, chromosome 15 at 98,593,568 bp
  • A to G, chromosome 16 at 38,827,863 bp
  • A to C, chromosome 16 at 58,717,816 bp
  • T to C, chromosome 17 at 43,037,916 bp
  • A to G, chromosome 18 at 44,010,252 bp
  • C to A, chromosome 19 at 38,141,421 bp
  • T to C, chromosome 19 at 56,837,708 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7643 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045700-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.