Strain Name:
C57BL/6J-MtgxR7654Btlr/Mmmh
Stock Number:
045702-MU
Citation ID:
RRID:MMRRC_045702-MU
Other Names:
R7654 (G1)
Major Collection:

Strain Information

Tgfb1
Name: transforming growth factor, beta 1
Synonyms: TGF-beta 1, Tgfb-1, Tgfb, TGFbeta1, TGF-beta1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21803
Homologene: 540
Gabrg1
Name: gamma-aminobutyric acid type A receptor subunit gamma 1
Synonyms: GabaA
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14405
HGNC: HGNC:4086
Homologene: 22570
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, Macf2, bullous pemphigoid antigen 1, athetoid, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 252870
Homologene: 2592
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Hspa4
Name: heat shock protein 4
Synonyms: APG-2, Hsp70RY, Hsp110, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Usp30
Name: ubiquitin specific peptidase 30
Synonyms: 6330590F17Rik, D5Ertd483e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100756
Homologene: 32789
Polk
Name: polymerase (DNA directed), kappa
Synonyms: Dinb1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27015
VEGA: 13
HGNC: HGNC:9183
Homologene: 32140
Aebp2
Name: AE binding protein 2
Synonyms: B230313N05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11569
Homologene: 40690
Ctc1
Name: CTS telomere maintenance complex component 1
Synonyms: 1500010J02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68964
Homologene: 11830
Pds5a
Name: PDS5 cohesin associated factor A
Synonyms: E230024D05Rik, 9030416H16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71521
Homologene: 22877
Ppfibp2
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: liprin beta 2, Cclp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19024
HGNC: HGNC:9250
Homologene: 7486
Leo1
Name: Leo1, Paf1/RNA polymerase II complex component
Synonyms: LOC235497
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235497
VEGA: 9
Homologene: 133895
Phkb
Name: phosphorylase kinase beta
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102093
HGNC: HGNC:8927
Homologene: 247
Arid1b
Name: AT-rich interaction domain 1B
Synonyms: B230217J03Rik, 9330189K18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 239985
Homologene: 32344
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Pcx
Name: pyruvate carboxylase
Synonyms: Pc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18563
VEGA: 19
HGNC: HGNC:8636
Homologene: 5422
Flvcr1
Name: feline leukemia virus subgroup C cellular receptor 1
Synonyms: 9630055N22Rik, Mfsd7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226844
Homologene: 56661
Alb
Name: albumin
Synonyms: Alb-1, Alb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11657
HGNC: HGNC:399
Homologene: 405
Gdpd5
Name: glycerophosphodiester phosphodiesterase domain containing 5
Synonyms: Gde2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233552
Homologene: 32741
Ctsa
Name: cathepsin A
Synonyms: PPCA, Ppgb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19025
HGNC: HGNC:9251
Homologene: 80163
Rab22a
Name: RAB22A, member RAS oncogene family
Synonyms: E130120E14Rik, 3732413A17Rik, Rab22
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19334
HGNC: HGNC:9764
Homologene: 10782
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Knop1
Name: lysine rich nucleolar protein 1
Synonyms: Tsg118, 2310008H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66356
Homologene: 49729
Inpp4a
Name: inositol polyphosphate-4-phosphatase, type I
Synonyms: 107kDa
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269180
HGNC: HGNC:6074
Homologene: 2871
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Irbp, Rbp-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Cat
Name: catalase
Synonyms: Cs-1, Cas-1, Cas1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12359
HGNC: HGNC:1516
Homologene: 55514
Mthfd2l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like
Synonyms: C630010D07Rik, 1110019K23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665563
Homologene: 28295
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
Zfyve28
Name: zinc finger, FYVE domain containing 28
Synonyms: 9630058O20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231125
Homologene: 15119
Tnik
Name: TRAF2 and NCK interacting kinase
Synonyms: 4831440I19Rik, 1500031A17Rik, C530008O15Rik, C630040K21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 665113
Homologene: 77943
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269959
Homologene: 18912
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: PC6, SPC6, PC5A, PC5/6A, b2b585Clo, b2b1549Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Cyp2b9
Name: cytochrome P450, family 2, subfamily b, polypeptide 9
Synonyms: Cyp2b, phenobarbitol inducible, type a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13094
HGNC: HGNC:2615
Homologene: 74933
Zfp804b
Name: zinc finger protein 804B
Synonyms: LOC207618
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 207618
Homologene: 52304
Ces1f
Name: carboxylesterase 1F
Synonyms: TGH-2, CesML1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234564
HGNC: HGNC:1863
Homologene: 134311
Adcy5
Name: adenylate cyclase 5
Synonyms: AC5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224129
VEGA: 16
HGNC: HGNC:236
Homologene: 11213
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 1110004O12Rik, 9130019P20Rik, 4933432B13Rik, A530027J04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108857
Homologene: 87006
Otoa
Name: otoancorin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246190
Homologene: 71803
Cfap65
Name: cilia and flagella associated protein 65
Synonyms: B230363K08Rik, Ccdc108
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241116
Homologene: 28093
Shroom1
Name: shroom family member 1
Synonyms: 1300007L22Rik, Shrm1, Apx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71774
Homologene: 12411
Il18
Name: interleukin 18
Synonyms: Il-18, Igif
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16173
VEGA: 9
HGNC: HGNC:5986
Homologene: 1200
Gnptab
Name: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: EG432486
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432486
Homologene: 32576
Ppip5k1
Name: diphosphoinositol pentakisphosphate kinase 1
Synonyms: B430315C20Rik, Hisppd2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 327655
Homologene: 49395
Sh3rf2
Name: SH3 domain containing ring finger 2
Synonyms: RNF158, 9130023G24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269016
Homologene: 17618
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327963
Homologene: 88945
Abcc2
Name: ATP-binding cassette, sub-family member 2
Synonyms: multidrug resistance protein 2, Mrp2, Cmoat
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Ccdc78
Name: coiled-coil domain containing 78
Synonyms: LOC381146, LOC381077
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381077
VEGA: 17
Homologene: 105408
Or5m12
Name: olfactory receptor family 5 subfamily M member 12
Synonyms: GA_x6K02T2Q125-47384320-47383337, MOR197-1, Olfr1024
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257900
Homologene: 128271
Hif3a
Name: hypoxia inducible factor 3, alpha subunit
Synonyms: MOP7, bHLHe17, Nepas
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53417
Homologene: 9646
Etnppl
Name: ethanolamine phosphate phospholyase
Synonyms: 1300019H02Rik, Agxt2l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71760
Homologene: 69440
Rcbtb2
Name: regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 2
Synonyms: 2810420M18Rik, 2610028E02Rik, Chc1l, Rc/btb2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105670
HGNC: HGNC:1914
Homologene: 970
Vmn2r65
Name: vomeronasal 2, receptor 65
Synonyms: ENSMUSG00000070600
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100009609
Plbd1
Name: phospholipase B domain containing 1
Synonyms: 1100001H23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66857
Homologene: 11745
B3gntl1
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1
Synonyms: 6030413G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 210004
Homologene: 14460
Redic1
Name: regulator of DNA class I crossover intermediates 1
Synonyms: Gm5807, CN725425
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545126
Neurl1b
Name: neuralized E3 ubiquitin protein ligase 1B
Synonyms: EG240055, C230078M08Rik, Neur2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240055
Homologene: 35443
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Phtf2
Name: putative homeodomain transcription factor 2
Synonyms: 9530062N20Rik, 1110054G21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68770
Homologene: 10713
Fuca1
Name: fucosidase, alpha-L- 1, tissue
Synonyms: Afuc, 0610006A03Rik, 9530055J05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71665
HGNC: HGNC:4006
Homologene: 20078
Rab3gap1
Name: RAB3 GTPase activating protein subunit 1
Synonyms: 1700003B17Rik, 4732493F09Rik, p130
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226407
Homologene: 45617
Speer4f2
Name: spermatogenesis associated glutamate (E)-rich protein 4f2
Synonyms: Gm3535, Gm3495
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100041749
Msl1
Name: male specific lethal 1
Synonyms: 4930463F05Rik, 2810017F12Rik, 4121402D02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74026
Homologene: 129785
Gpt
Name: glutamic pyruvic transaminase, soluble
Synonyms: Gpt-1, 1300007J06Rik, 2310022B03Rik, ALT, Gpt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76282
VEGA: 15
HGNC: HGNC:4552
Homologene: 134231
Pgam2
Name: phosphoglycerate mutase 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56012
HGNC: HGNC:8889
Homologene: 56228
Mpnd
Name: MPN domain containing
Synonyms: E130307M08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68047
Homologene: 12231
Ptpn20
Name: protein tyrosine phosphatase, non-receptor type 20
Synonyms: typ
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19256
VEGA: 14
Homologene: 74905
Umad1
Name: UMAP1-MVP12 associated (UMA) domain containing 1
Synonyms: Gm16039
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100036521
Asl
Name: argininosuccinate lyase
Synonyms: 2510006M18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109900
HGNC: HGNC:746
Homologene: 32
Pcdhac2
Name: protocadherin alpha subfamily C, 2
Synonyms: CNRc2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353237
HGNC: HGNC:8677
Homologene: 49562
Sprr2b
Name: small proline-rich protein 2B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20756
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 34,228,977 bp
  • A to T, chromosome 1 at 34,228,978 bp
  • A to G, chromosome 1 at 37,374,098 bp
  • A to T, chromosome 1 at 74,933,144 bp
  • A to G, chromosome 1 at 127,909,915 bp
  • A to T, chromosome 1 at 191,011,605 bp
  • A to G, chromosome 2 at 31,346,569 bp
  • T to C, chromosome 2 at 76,897,146 bp
  • A to T, chromosome 2 at 77,042,478 bp
  • G to T, chromosome 2 at 85,904,319 bp
  • G to A, chromosome 2 at 103,460,364 bp
  • G to A, chromosome 2 at 121,348,559 bp
  • A to T, chromosome 2 at 158,008,554 bp
  • C to T, chromosome 2 at 164,838,933 bp
  • T to C, chromosome 2 at 173,688,175 bp
  • C to T, chromosome 3 at 28,604,185 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • A to G, chromosome 3 at 130,629,511 bp
  • T to C, chromosome 4 at 135,929,921 bp
  • T to A, chromosome 5 at 6,769,458 bp
  • A to T, chromosome 5 at 17,374,415 bp
  • A to G, chromosome 5 at 20,782,461 bp
  • A to T, chromosome 5 at 34,243,195 bp
  • A to G, chromosome 5 at 65,618,981 bp
  • T to C, chromosome 5 at 70,778,161 bp
  • G to C, chromosome 5 at 90,467,355 bp
  • A to T, chromosome 5 at 90,946,806 bp
  • T to A, chromosome 5 at 114,102,445 bp
  • C to A, chromosome 5 at 130,018,390 bp
  • G to A, chromosome 6 at 8,426,995 bp
  • A to G, chromosome 6 at 38,177,701 bp
  • T to C, chromosome 6 at 136,651,866 bp
  • T to A, chromosome 6 at 140,653,748 bp
  • C to T, chromosome 7 at 17,049,096 bp
  • A to T, chromosome 7 at 25,687,695 bp
  • A to G, chromosome 7 at 26,186,942 bp
  • A to C, chromosome 7 at 82,574,494 bp
  • A to G, chromosome 7 at 84,941,053 bp
  • G to A, chromosome 7 at 99,424,189 bp
  • T to A, chromosome 7 at 107,738,611 bp
  • A to G, chromosome 7 at 118,845,809 bp
  • T to G, chromosome 7 at 121,147,700 bp
  • G to T, chromosome 8 at 85,940,887 bp
  • T to G, chromosome 8 at 93,271,934 bp
  • G to A, chromosome 8 at 109,638,417 bp
  • A to T, chromosome 9 at 7,122,664 bp
  • A to G, chromosome 9 at 50,579,401 bp
  • A to T, chromosome 9 at 75,455,679 bp
  • T to A, chromosome 10 at 88,445,819 bp
  • T to C, chromosome 11 at 5,803,351 bp
  • C to A, chromosome 11 at 53,300,124 bp
  • T to A, chromosome 11 at 53,466,908 bp
  • C to T, chromosome 11 at 69,026,215 bp
  • A to G, chromosome 11 at 74,083,187 bp
  • C to T, chromosome 11 at 98,169,363 bp
  • A to G, chromosome 11 at 98,796,111 bp
  • T to A, chromosome 11 at 121,651,613 bp
  • T to C, chromosome 13 at 96,496,813 bp
  • A to G, chromosome 14 at 33,638,324 bp
  • T to C, chromosome 14 at 33,955,840 bp
  • T to C, chromosome 14 at 73,174,501 bp
  • A to G, chromosome 15 at 76,698,330 bp
  • T to A, chromosome 15 at 91,239,435 bp
  • G to A, chromosome 16 at 8,702,043 bp
  • T to C, chromosome 16 at 35,270,947 bp
  • T to A, chromosome 17 at 5,291,085 bp
  • T to C, chromosome 17 at 25,790,111 bp
  • T to A, chromosome 17 at 26,438,697 bp
  • T to G, chromosome 17 at 56,010,489 bp
  • T to C, chromosome 18 at 36,594,101 bp
  • T to A, chromosome 18 at 37,145,023 bp
  • A to G, chromosome 18 at 42,104,108 bp
  • T to A, chromosome 19 at 4,515,669 bp
  • C to G, chromosome 19 at 10,248,206 bp
  • T to A, chromosome 19 at 17,456,804 bp
  • G to A, chromosome 19 at 43,826,593 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7654 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045702-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.