Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7654Btlr/Mmmh
Stock Number:
045702-MU
Citation ID:
RRID:MMRRC_045702-MU
Other Names:
R7654 (G1)
Major Collection:

Strain Information

Tgfb1
Name: transforming growth factor, beta 1
Synonyms: TGF-beta 1, Tgfb-1, Tgfb, TGFbeta1, TGF-beta1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21803
Homologene: 540
Gabrg1
Name: gamma-aminobutyric acid type A receptor subunit gamma 1
Synonyms: GabaA
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14405
HGNC: HGNC:4086
Homologene: 22570
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Usp7
Name: ubiquitin specific peptidase 7
Synonyms: 2210010O09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 252870
Homologene: 2592
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 34,228,977 bp
  • A to T, chromosome 1 at 34,228,978 bp
  • A to G, chromosome 1 at 37,374,098 bp
  • A to T, chromosome 1 at 74,933,144 bp
  • A to G, chromosome 1 at 127,909,915 bp
  • A to T, chromosome 1 at 191,011,605 bp
  • A to G, chromosome 2 at 31,346,569 bp
  • T to C, chromosome 2 at 76,897,146 bp
  • A to T, chromosome 2 at 77,042,478 bp
  • G to T, chromosome 2 at 85,904,319 bp
  • G to A, chromosome 2 at 103,460,364 bp
  • G to A, chromosome 2 at 121,348,559 bp
  • A to T, chromosome 2 at 158,008,554 bp
  • C to T, chromosome 2 at 164,838,933 bp
  • T to C, chromosome 2 at 173,688,175 bp
  • C to T, chromosome 3 at 28,604,185 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • A to G, chromosome 3 at 130,629,511 bp
  • T to C, chromosome 4 at 135,929,921 bp
  • T to A, chromosome 5 at 6,769,458 bp
  • A to T, chromosome 5 at 17,374,415 bp
  • A to G, chromosome 5 at 20,782,461 bp
  • A to T, chromosome 5 at 34,243,195 bp
  • A to G, chromosome 5 at 65,618,981 bp
  • T to C, chromosome 5 at 70,778,161 bp
  • G to C, chromosome 5 at 90,467,355 bp
  • A to T, chromosome 5 at 90,946,806 bp
  • T to A, chromosome 5 at 114,102,445 bp
  • C to A, chromosome 5 at 130,018,390 bp
  • G to A, chromosome 6 at 8,426,995 bp
  • A to G, chromosome 6 at 38,177,701 bp
  • T to C, chromosome 6 at 136,651,866 bp
  • T to A, chromosome 6 at 140,653,748 bp
  • C to T, chromosome 7 at 17,049,096 bp
  • A to T, chromosome 7 at 25,687,695 bp
  • A to G, chromosome 7 at 26,186,942 bp
  • A to C, chromosome 7 at 82,574,494 bp
  • A to G, chromosome 7 at 84,941,053 bp
  • G to A, chromosome 7 at 99,424,189 bp
  • T to A, chromosome 7 at 107,738,611 bp
  • A to G, chromosome 7 at 118,845,809 bp
  • T to G, chromosome 7 at 121,147,700 bp
  • G to T, chromosome 8 at 85,940,887 bp
  • T to G, chromosome 8 at 93,271,934 bp
  • G to A, chromosome 8 at 109,638,417 bp
  • A to T, chromosome 9 at 7,122,664 bp
  • A to G, chromosome 9 at 50,579,401 bp
  • A to T, chromosome 9 at 75,455,679 bp
  • T to A, chromosome 10 at 88,445,819 bp
  • T to C, chromosome 11 at 5,803,351 bp
  • C to A, chromosome 11 at 53,300,124 bp
  • T to A, chromosome 11 at 53,466,908 bp
  • C to T, chromosome 11 at 69,026,215 bp
  • A to G, chromosome 11 at 74,083,187 bp
  • C to T, chromosome 11 at 98,169,363 bp
  • A to G, chromosome 11 at 98,796,111 bp
  • T to A, chromosome 11 at 121,651,613 bp
  • T to C, chromosome 13 at 96,496,813 bp
  • A to G, chromosome 14 at 33,638,324 bp
  • T to C, chromosome 14 at 33,955,840 bp
  • T to C, chromosome 14 at 73,174,501 bp
  • A to G, chromosome 15 at 76,698,330 bp
  • T to A, chromosome 15 at 91,239,435 bp
  • G to A, chromosome 16 at 8,702,043 bp
  • T to C, chromosome 16 at 35,270,947 bp
  • T to A, chromosome 17 at 5,291,085 bp
  • T to C, chromosome 17 at 25,790,111 bp
  • T to A, chromosome 17 at 26,438,697 bp
  • T to G, chromosome 17 at 56,010,489 bp
  • T to C, chromosome 18 at 36,594,101 bp
  • T to A, chromosome 18 at 37,145,023 bp
  • A to G, chromosome 18 at 42,104,108 bp
  • T to A, chromosome 19 at 4,515,669 bp
  • C to G, chromosome 19 at 10,248,206 bp
  • T to A, chromosome 19 at 17,456,804 bp
  • G to A, chromosome 19 at 43,826,593 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7654 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045702-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.