Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7565Btlr/Mmmh
Stock Number:
045710-MU
Citation ID:
RRID:MMRRC_045710-MU
Other Names:
R7565 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Rpl13a
Name: ribosomal protein L13A
Synonyms: tum-antigen, tum-transplantation antigen P198, Tstap198-7, 1810026N22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22121
Homologene: 111053
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Bmp6
Name: bone morphogenetic protein 6
Synonyms: Vgr1, D13Wsu115e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12161
VEGA: 13
HGNC: HGNC:1073
Homologene: 1300
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Usp38
Name: ubiquitin specific peptidase 38
Synonyms: 4631402N15Rik, 4833420O05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74841
Homologene: 12367
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, Mypt1, D10Ertd625e, 5730577I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 13,148,376 bp
  • A to T, chromosome 1 at 26,685,270 bp
  • C to A, chromosome 1 at 120,474,666 bp
  • T to C, chromosome 1 at 155,307,742 bp
  • T to C, chromosome 1 at 160,251,417 bp
  • A to T, chromosome 2 at 22,946,584 bp
  • A to T, chromosome 2 at 23,160,220 bp
  • A to G, chromosome 2 at 80,292,990 bp
  • C to T, chromosome 2 at 82,949,512 bp
  • A to G, chromosome 2 at 172,992,071 bp
  • T to A, chromosome 2 at 181,991,257 bp
  • A to G, chromosome 2 at 182,000,837 bp
  • T to C, chromosome 3 at 5,390,366 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT to CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT, chromosome 3 at 95,888,138 bp
  • TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG to TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG, chromosome 3 at 95,888,144 bp
  • T to C, chromosome 3 at 101,018,792 bp
  • T to G, chromosome 3 at 115,122,744 bp
  • T to A, chromosome 3 at 115,892,797 bp
  • T to C, chromosome 3 at 124,321,907 bp
  • A to G, chromosome 4 at 21,784,790 bp
  • G to A, chromosome 4 at 81,303,654 bp
  • G to A, chromosome 4 at 154,980,550 bp
  • T to A, chromosome 5 at 36,748,345 bp
  • A to T, chromosome 5 at 62,843,092 bp
  • A to G, chromosome 5 at 73,033,720 bp
  • T to C, chromosome 5 at 75,948,843 bp
  • A to G, chromosome 5 at 124,799,031 bp
  • T to A, chromosome 6 at 24,765,934 bp
  • C to T, chromosome 6 at 29,499,187 bp
  • T to C, chromosome 6 at 71,141,327 bp
  • T to A, chromosome 6 at 142,492,519 bp
  • C to T, chromosome 7 at 19,812,494 bp
  • A to T, chromosome 7 at 29,712,981 bp
  • C to T, chromosome 7 at 45,127,042 bp
  • T to C, chromosome 7 at 85,565,291 bp
  • T to C, chromosome 7 at 106,678,126 bp
  • T to A, chromosome 7 at 107,181,887 bp
  • A to T, chromosome 7 at 119,716,862 bp
  • A to T, chromosome 7 at 128,183,015 bp
  • T to A, chromosome 8 at 80,981,972 bp
  • C to T, chromosome 9 at 62,850,757 bp
  • A to G, chromosome 10 at 77,597,036 bp
  • G to A, chromosome 10 at 79,887,045 bp
  • A to T, chromosome 10 at 84,587,134 bp
  • G to A, chromosome 10 at 108,268,640 bp
  • A to G, chromosome 10 at 129,608,160 bp
  • T to C, chromosome 11 at 62,401,265 bp
  • T to A, chromosome 12 at 100,616,083 bp
  • C to T, chromosome 13 at 11,560,653 bp
  • C to T, chromosome 13 at 23,136,660 bp
  • C to T, chromosome 13 at 38,346,257 bp
  • A to G, chromosome 13 at 50,433,362 bp
  • T to C, chromosome 13 at 55,784,725 bp
  • A to G, chromosome 13 at 73,790,772 bp
  • G to A, chromosome 13 at 74,157,694 bp
  • A to T, chromosome 14 at 60,751,849 bp
  • A to C, chromosome 14 at 66,151,035 bp
  • G to A, chromosome 14 at 87,506,593 bp
  • A to G, chromosome 14 at 101,885,301 bp
  • A to G, chromosome 15 at 82,760,774 bp
  • T to C, chromosome 16 at 17,147,005 bp
  • T to A, chromosome 16 at 17,789,284 bp
  • C to A, chromosome 17 at 17,970,965 bp
  • T to G, chromosome 17 at 27,110,888 bp
  • T to C, chromosome 17 at 37,624,501 bp
  • T to A, chromosome 17 at 48,145,579 bp
  • A to G, chromosome 17 at 56,064,148 bp
  • C to T, chromosome 18 at 12,744,599 bp
  • A to C, chromosome 18 at 46,734,484 bp
  • G to A, chromosome 18 at 61,083,264 bp
  • C to A, chromosome 18 at 89,060,479 bp
  • A to G, chromosome 19 at 9,016,156 bp
  • T to A, chromosome 19 at 12,120,011 bp
  • T to C, chromosome 19 at 12,298,848 bp
  • T to A, chromosome 19 at 47,671,524 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7565 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045710-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.