Strain Name:
C57BL/6J-MtgxR7565Btlr/Mmmh
Stock Number:
045710-MU
Citation ID:
RRID:MMRRC_045710-MU
Other Names:
R7565 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: Rxrip13, A230020K14Rik, N-CoR, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Rpl13a
Name: ribosomal protein L13A
Synonyms: Tstap198-7, 1810026N22Rik, tum-transplantation antigen P198, tum-antigen
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22121
Homologene: 111053
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Bmp6
Name: bone morphogenetic protein 6
Synonyms: Vgr1, D13Wsu115e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12161
VEGA: 13
HGNC: HGNC:1073
Homologene: 1300
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 9030227G01Rik, 2510002A14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Usp38
Name: ubiquitin specific peptidase 38
Synonyms: 4631402N15Rik, 4833420O05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74841
Homologene: 12367
Ppp1r12a
Name: protein phosphatase 1, regulatory subunit 12A
Synonyms: 1200015F06Rik, D10Ertd625e, 5730577I22Rik, Mypt1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17931
VEGA: 10
HGNC: HGNC:7618
Homologene: 1855
Dph5
Name: diphthamide biosynthesis 5
Synonyms: 2410012M04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69740
Homologene: 6471
Chaf1a
Name: chromatin assembly factor 1, subunit A
Synonyms: p150, CAF-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27221
VEGA: 17
HGNC: HGNC:1910
Homologene: 4003
Rps6ka5
Name: ribosomal protein S6 kinase, polypeptide 5
Synonyms: 6330404E13Rik, MSK1, 3110005L17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73086
VEGA: 12
Homologene: 48302
Rttn
Name: rotatin
Synonyms: C530033I08Rik, 4921538A15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246102
VEGA: 18
Homologene: 65275
Abi1
Name: abl interactor 1
Synonyms: E3B1, Ssh3bp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11308
Homologene: 38053
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219249
Homologene: 12771
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Chrna2
Name: cholinergic receptor nicotinic alpha 2 subunit
Synonyms: Acra2, Acra-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110902
HGNC: HGNC:1956
Homologene: 20193
Lmo7
Name: LIM domain only 7
Synonyms: FBXO20, LOC380928
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 380928
HGNC: HGNC:6646
Homologene: 83924
Gm14496
Name: predicted gene 14496
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 672125
Homologene: 129606
Pdgfrb
Name: platelet derived growth factor receptor, beta polypeptide
Synonyms: Pdgfr, CD140b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18596
HGNC: HGNC:8804
Homologene: 1960
Olfm3
Name: olfactomedin 3
Synonyms: B230206G02Rik, optimedin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229759
Homologene: 17103
Ncoa2
Name: nuclear receptor coactivator 2
Synonyms: TIF-2, glucocorticoid receptor-interacting protein 1, D1Ertd433e, TIF2, KAT13C, TIF2/GRIP-1, bHLHe75, Grip1, SRC-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17978
HGNC: HGNC:7669
Homologene: 4768
Slc12a7
Name: solute carrier family 12, member 7
Synonyms: Kcc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20499
VEGA: 13
Homologene: 21312
Mpdz
Name: multiple PDZ domain crumbs cell polarity complex component
Synonyms: multiple PDZ domain protein, B930003D11Rik, MUPP1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17475
HGNC: HGNC:7208
Homologene: 2841
Yme1l1
Name: YME1-like 1 (S. cerevisiae)
Synonyms: Ftsh, ATP-dependent metalloprotease FtsH1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27377
Homologene: 31996
Thumpd1
Name: THUMP domain containing 1
Synonyms: 6330575P11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233802
Homologene: 5878
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: tf, Ip3r3, Itpr-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Hyal4
Name: hyaluronoglucosaminidase 4
Synonyms: 4632428M18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77042
HGNC: HGNC:5323
Homologene: 69117
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: C130041O22Rik, Zfh4, Zfh-4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Elane
Name: elastase, neutrophil expressed
Synonyms: Ela2, F430011M15Rik, NE
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 50701
VEGA: 10
HGNC: HGNC:3309
Homologene: 20455
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Marco
Name: macrophage receptor with collagenous structure
Synonyms: Scara2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17167
HGNC: HGNC:6895
Homologene: 4928
Kcp
Name: kielin/chordin-like protein
Synonyms: Crim2, LOC333088, KCP
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 333088
Homologene: 87817
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Xpr1
Name: xenotropic and polytropic retrovirus receptor 1
Synonyms: suppressor of yeast Ga deletion, Rmc1, Rmc-1, Syg1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19775
Homologene: 134226
Nlrp14
Name: NLR family, pyrin domain containing 14
Synonyms: GC-LRR, 4921520L01Rik, Nalp-iota, Nalp14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76858
Homologene: 18531
Spata31e2
Name: spermatogenesis associated 31 subfamily E member 2
Synonyms: 4931408C20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210940
Homologene: 86827
Tcp11l2
Name: t-complex 11 (mouse) like 2
Synonyms: E430026E19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216198
Homologene: 17129
9830107B12Rik
Name: RIKEN cDNA 9830107B12 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328829
VEGA: 17
Homologene: 136361
Vmn2r70
Name: vomeronasal 2, receptor 70
Synonyms: EG620835
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 670940
Homologene: 115466
Rabgap1l
Name: RAB GTPase activating protein 1-like
Synonyms: 9630005B12Rik, Hh1, 8430421H08Rik, 5830411O09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 29809
Homologene: 8143
Vmn1r218
Name: vomeronasal 1 receptor 218
Synonyms: V1ri5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171256
Homologene: 110880
Or14j10
Name: olfactory receptor family 14 subfamily J member 10
Synonyms: GA_x6K02T2PSCP-2084102-2083137, Olfr116, MOR218-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258625
Catsperg2
Name: cation channel sperm associated auxiliary subunit gamma 2
Synonyms: CATSPERG, 1700067C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76718
Homologene: 10915
Ahnak
Name: AHNAK nucleoprotein
Synonyms: 2310047C17Rik, 1110004P15Rik, DY6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Itgad
Name: integrin, alpha D
Synonyms: Cd11d
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381924
HGNC: HGNC:6146
Homologene: 56919
Cd101
Name: CD101 antigen
Synonyms: Igsf2, LOC381460
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 630146
HGNC: HGNC:5949
Homologene: 3142
Cyp2d40
Name: cytochrome P450, family 2, subfamily d, polypeptide 40
Synonyms: 1300013D18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71754
VEGA: 15
Homologene: 135470
Slc9a3
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 3
Synonyms: NHE3, 9030624O13Rik, NHE-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105243
VEGA: 13
Homologene: 55804
Or10p1
Name: olfactory receptor family 10 subfamily P member 1
Synonyms: MOR269-1, GA_x6K02T2PULF-11287099-11286167, Olfr796
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258933
Homologene: 17439
Dthd1
Name: death domain containing 1
Synonyms: Gm17384
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100322896
Homologene: 123510
Bcl3
Name: B cell leukemia/lymphoma 3
Synonyms: Bcl-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12051
HGNC: HGNC:998
Homologene: 81738
Kdr
Name: kinase insert domain protein receptor
Synonyms: Flk1, orv, VEGFR-2, Flk-1, VEGF receptor-2, VEGFR2, vascular endothelial growth factor receptor- 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16542
HGNC: HGNC:6307
Homologene: 55639
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Or2ag12
Name: olfactory receptor family 2 subfamily AG member 12
Synonyms: Olfr693, MOR283-8, GA_x6K02T2PBJ9-9055944-9054994
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258445
Col17a1
Name: collagen, type XVII, alpha 1
Synonyms: Bpag2, Bpag, BP180, BPAg2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12821
HGNC: HGNC:2194
Homologene: 7276
Catsper3
Name: cation channel, sperm associated 3
Synonyms: 4921522D01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76856
Homologene: 12658
Spata13
Name: spermatogenesis associated 13
Synonyms: ESTM11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219140
Homologene: 19482
Usp45
Name: ubiquitin specific petidase 45
Synonyms: Gcap7, 4930550B20Rik, 3110003C05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77593
Homologene: 17674
Ldhb
Name: lactate dehydrogenase B
Synonyms: lactate dehydrogenase-B, H-Ldh, Ldh-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16832
HGNC: HGNC:6541
Homologene: 55647
Or5a1
Name: olfactory receptor family 5 subfamily A member 1
Synonyms: Olfr76, MOR215-3, GA_x6K02T2RE5P-2479601-2478648, V5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258677
HGNC: HGNC:8319
Homologene: 17342
Fbxw17
Name: F-box and WD-40 domain protein 17
Synonyms: 1110064L07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109082
Homologene: 82571
Thnsl2
Name: threonine synthase-like 2 (bacterial)
Synonyms: TSH2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232078
Homologene: 5489
Prdx6b
Name: peroxiredoxin 6B
Synonyms: 4930414C22Rik, Prdx6-ps1, 1-cysPrx-P1, Aop2-rs1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320769
Homologene: 71226
Atg12
Name: autophagy related 12
Synonyms: A330058M13Rik, 4931423H11Rik, Apg12l
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67526
VEGA: 18
HGNC: HGNC:588
Homologene: 37953
Cabyr
Name: calcium binding tyrosine phosphorylation regulated
Synonyms: 1700016C01Rik, FSP-2, CBP86, 4933421A18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71132
Homologene: 49299
Klhl22
Name: kelch-like 22
Synonyms: Kelchl, 2610318I18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224023
Homologene: 23784
Or5an10
Name: olfactory receptor family 5 subfamily AN member 10
Synonyms: GA_x6K02T2RE5P-2634596-2633658, Olfr1436, MOR214-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258682
Homologene: 83129
Cln6
Name: ceroid-lipofuscinosis, neuronal 6
Synonyms: 1810065L06Rik, D9Bwg1455e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76524
HGNC: HGNC:2077
Homologene: 9898
Tram1l1
Name: translocation associated membrane protein 1-like 1
Synonyms: A830091N21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229801
Homologene: 17142
Fpr3
Name: formyl peptide receptor 3
Synonyms: Lxa4r, Fprl1, LXA4-R, Fpr-rs1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14294
Ydjc
Name: YdjC homolog (bacterial)
Synonyms: 4930521M19Rik, 1810015A11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69101
Homologene: 19062
Spo11
Name: SPO11 initiator of meiotic double stranded breaks
Synonyms: Spo11a, Spo11b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26972
Homologene: 6059
Pttg1ip
Name: pituitary tumor-transforming 1 interacting protein
Synonyms: 1810010L20Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108705
Homologene: 3203
Bloc1s4
Name: biogenesis of lysosomal organelles complex-1, subunit 4, cappuccino
Synonyms: Cno, Blos4, 2610101N07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117197
Homologene: 10155
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 13,148,376 bp
  • A to T, chromosome 1 at 26,685,270 bp
  • C to A, chromosome 1 at 120,474,666 bp
  • T to C, chromosome 1 at 155,307,742 bp
  • T to C, chromosome 1 at 160,251,417 bp
  • A to T, chromosome 2 at 22,946,584 bp
  • A to T, chromosome 2 at 23,160,220 bp
  • A to G, chromosome 2 at 80,292,990 bp
  • C to T, chromosome 2 at 82,949,512 bp
  • A to G, chromosome 2 at 172,992,071 bp
  • T to A, chromosome 2 at 181,991,257 bp
  • A to G, chromosome 2 at 182,000,837 bp
  • T to C, chromosome 3 at 5,390,366 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • CACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT to CACTGGTTCTGTGGTGACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGT, chromosome 3 at 95,888,138 bp
  • TTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG to TTCTGTGGTCACTGGGTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGG, chromosome 3 at 95,888,144 bp
  • T to C, chromosome 3 at 101,018,792 bp
  • T to G, chromosome 3 at 115,122,744 bp
  • T to A, chromosome 3 at 115,892,797 bp
  • T to C, chromosome 3 at 124,321,907 bp
  • A to G, chromosome 4 at 21,784,790 bp
  • G to A, chromosome 4 at 81,303,654 bp
  • G to A, chromosome 4 at 154,980,550 bp
  • T to A, chromosome 5 at 36,748,345 bp
  • A to T, chromosome 5 at 62,843,092 bp
  • A to G, chromosome 5 at 73,033,720 bp
  • T to C, chromosome 5 at 75,948,843 bp
  • A to G, chromosome 5 at 124,799,031 bp
  • T to A, chromosome 6 at 24,765,934 bp
  • C to T, chromosome 6 at 29,499,187 bp
  • T to C, chromosome 6 at 71,141,327 bp
  • T to A, chromosome 6 at 142,492,519 bp
  • C to T, chromosome 7 at 19,812,494 bp
  • A to T, chromosome 7 at 29,712,981 bp
  • C to T, chromosome 7 at 45,127,042 bp
  • T to C, chromosome 7 at 85,565,291 bp
  • T to C, chromosome 7 at 106,678,126 bp
  • T to A, chromosome 7 at 107,181,887 bp
  • A to T, chromosome 7 at 119,716,862 bp
  • A to T, chromosome 7 at 128,183,015 bp
  • T to A, chromosome 8 at 80,981,972 bp
  • C to T, chromosome 9 at 62,850,757 bp
  • A to G, chromosome 10 at 77,597,036 bp
  • G to A, chromosome 10 at 79,887,045 bp
  • A to T, chromosome 10 at 84,587,134 bp
  • G to A, chromosome 10 at 108,268,640 bp
  • A to G, chromosome 10 at 129,608,160 bp
  • T to C, chromosome 11 at 62,401,265 bp
  • T to A, chromosome 12 at 100,616,083 bp
  • C to T, chromosome 13 at 11,560,653 bp
  • C to T, chromosome 13 at 23,136,660 bp
  • C to T, chromosome 13 at 38,346,257 bp
  • A to G, chromosome 13 at 50,433,362 bp
  • T to C, chromosome 13 at 55,784,725 bp
  • A to G, chromosome 13 at 73,790,772 bp
  • G to A, chromosome 13 at 74,157,694 bp
  • A to T, chromosome 14 at 60,751,849 bp
  • A to C, chromosome 14 at 66,151,035 bp
  • G to A, chromosome 14 at 87,506,593 bp
  • A to G, chromosome 14 at 101,885,301 bp
  • A to G, chromosome 15 at 82,760,774 bp
  • T to C, chromosome 16 at 17,147,005 bp
  • T to A, chromosome 16 at 17,789,284 bp
  • C to A, chromosome 17 at 17,970,965 bp
  • T to G, chromosome 17 at 27,110,888 bp
  • T to C, chromosome 17 at 37,624,501 bp
  • T to A, chromosome 17 at 48,145,579 bp
  • A to G, chromosome 17 at 56,064,148 bp
  • C to T, chromosome 18 at 12,744,599 bp
  • A to C, chromosome 18 at 46,734,484 bp
  • G to A, chromosome 18 at 61,083,264 bp
  • C to A, chromosome 18 at 89,060,479 bp
  • A to G, chromosome 19 at 9,016,156 bp
  • T to A, chromosome 19 at 12,120,011 bp
  • T to C, chromosome 19 at 12,298,848 bp
  • T to A, chromosome 19 at 47,671,524 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7565 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045710-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.