Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7670Btlr/Mmmh
Stock Number:
045742-MU
Citation ID:
RRID:MMRRC_045742-MU
Other Names:
R7670 (G1)
Major Collection:

Strain Information

Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Fam117a
Name: family with sequence similarity 117, member A
Synonyms: 5730593F17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215512
Homologene: 12775
Aspscr1
Name: ASPSCR1 tether for SLC2A4, UBX domain containing
Synonyms: ASPCR1, RCC17, ASPC, 1190006K01Rik, TUG, ASPL
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68938
Homologene: 41550
Ncbp1
Name: nuclear cap binding protein subunit 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433702
HGNC: HGNC:7658
Homologene: 1859
Clic4
Name: chloride intracellular channel 4
Synonyms: mtCLIC, mc3s5, D0Jmb3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29876
Homologene: 8490
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Arrdc3
Name: arrestin domain containing 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105171
Homologene: 69318
Nufip1
Name: nuclear FMR1 interacting protein 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27275
VEGA: 14
HGNC: HGNC:8057
Homologene: 8216
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: Znf295, 5430437K12Rik, B430213I24Rik, Zfp295
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114565
VEGA: 16
Homologene: 10799
Rreb1
Name: ras responsive element binding protein 1
Synonyms: 1110037N09Rik, B930013M22Rik, sao
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68750
Homologene: 2218
Stmn2
Name: stathmin-like 2
Synonyms: SCG10, Scgn10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20257
Homologene: 5102
Pcnx3
Name: pecanex homolog 3
Synonyms: Pcnxl3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104401
Homologene: 17000
Gemin5
Name: gem nuclear organelle associated protein 5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216766
Homologene: 9155
Pcdhb18
Name: protocadherin beta 18
Synonyms: Pcdhb9, PcdhbR
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Slc9a2
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 2
Synonyms: NHE2, 4932415O19Rik, 2210416H12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226999
Homologene: 20661
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Cdc42bpa
Name: CDC42 binding protein kinase alpha
Synonyms: DMPK-like, A930014J19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226751
HGNC: HGNC:1737
Homologene: 55765
Col12a1
Name: collagen, type XII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12816
HGNC: HGNC:2188
Homologene: 3217
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 4833413O10Rik, D430029O09Rik, 1110021D17Rik, Polydom
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Tns1
Name: tensin 1
Synonyms: 1200014E20Rik, E030018G17Rik, 1110018I21Rik, Tns, E030037J05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21961
Homologene: 11219
Rsph4a
Name: radial spoke head 4 homolog A (Chlamydomonas)
Synonyms: Rshl3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212892
Homologene: 71779
Ddx60
Name: DExD/H box helicase 60
Synonyms: DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234311
Homologene: 23031
Top2b
Name: topoisomerase (DNA) II beta
Synonyms: Top-2, D230016L12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21974
Homologene: 134711
Nuggc
Name: nuclear GTPase, germinal center associated
Synonyms: LOC239151, Gm600, SLIP-GC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100503545
Homologene: 72641
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Nme8
Name: NME/NM23 family member 8
Synonyms: 1700056P15Rik, Sptrx-2, Txndc3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73412
Homologene: 9593
Serpina3f
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3F
Synonyms: 2A1, antitrypsin, alpha-1 antiproteinasin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238393
HGNC: HGNC:16
Homologene: 115927
Zfp27
Name: zinc finger protein 27
Synonyms: mkr-4, Zfp-27
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22689
Homologene: 81823
Adipoq
Name: adiponectin, C1Q and collagen domain containing
Synonyms: adiponectin, adipo, apM1, GBP28, Acrp30, Acdc, APN, Ad
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11450
Homologene: 3525
Adam26a
Name: ADAM metallopeptidase domain 26A
Synonyms: Dtgn4, Adam26
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13525
Homologene: 128363
Arhgap40
Name: Rho GTPase activating protein 40
Synonyms: Gm14203
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545481
Homologene: 53500
Herc6
Name: hect domain and RLD 6
Synonyms: 4930427L17Rik, 1700121D12Rik, CEB1, 2510038N07Rik, Herc5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67138
Homologene: 70768
Tex55
Name: testis expressed 55
Synonyms: 4930435E12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74663
Homologene: 17614
Lcp1
Name: lymphocyte cytosolic protein 1
Synonyms: L-fimbrin, Pls2, D14Ertd310e, L-plastin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18826
HGNC: HGNC:6528
Homologene: 80174
Ctsk
Name: cathepsin K
Synonyms: Cat K, catK
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13038
HGNC: HGNC:2536
Homologene: 68053
Rnf31
Name: ring finger protein 31
Synonyms: Paul, HOIP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268749
Homologene: 33228
Ccr9
Name: C-C motif chemokine receptor 9
Synonyms: GPR-9-6, Cmkbr10
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12769
HGNC: HGNC:1610
Homologene: 22546
Klrb1
Name: killer cell lectin-like receptor subfamily B member 1
Synonyms: Ly-55, Ly55, Gm4696, 4930431A04Rik, Nkrp1g
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100043861
HGNC: HGNC:6373
Homologene: 135763
Zfp62
Name: zinc finger protein 62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22720
Homologene: 40686
Otud4
Name: OTU domain containing 4
Synonyms: 4930431L18Rik, D8Ertd69e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73945
Homologene: 35370
Rbm24
Name: RNA binding motif protein 24
Synonyms: 6330546B05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 666794
VEGA: 13
Homologene: 23015
Adgrf2
Name: adhesion G protein-coupled receptor F2
Synonyms: PGR20, Gpr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 435529
Homologene: 45213
Neurl1b
Name: neuralized E3 ubiquitin protein ligase 1B
Synonyms: EG240055, Neur2, C230078M08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240055
Homologene: 35443
Or1a1
Name: olfactory receptor family 1 subfamily A member 1
Synonyms: GA_x6K02T2P1NL-4348188-4349129, MOR125-5_p, IA7, Olfr403
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 404316
Homologene: 8219
Txndc16
Name: thioredoxin domain containing 16
Synonyms: 5730420B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70561
Homologene: 18197
Retreg1
Name: reticulophagy regulator 1
Synonyms: 1810015C04Rik, Fam134b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66270
VEGA: 15
Homologene: 10368
Reep6
Name: receptor accessory protein 6
Synonyms: Dp1l1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70335
Homologene: 133833
Lin7a
Name: lin-7 homolog A, crumbs cell polarity complex component
Synonyms: LIN-7A, TIP-33, MALS-1, Veli
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108030
VEGA: 10
Homologene: 20976
Pacc1
Name: proton activated chloride channel 1
Synonyms: 2310028N02Rik, Tmem206
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66950
Homologene: 10097
Ubl7
Name: ubiquitin-like 7 (bone marrow stromal cell-derived)
Synonyms: 2300004C15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69459
VEGA: 9
Homologene: 12312
Krtap31-1
Name: keratin associated protein 31-1
Synonyms: 4733401H21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70831
Homologene: 134336
Or5c1
Name: olfactory receptor family 5 subfamily C member 1
Synonyms: GA_x6K02T2NLDC-34015743-34016726, MOR178-1, Olfr368
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258371
HGNC: HGNC:8331
Homologene: 71970
Gm5145
Name: predicted pseudogene 5145
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381065
VEGA: 17
Eif1ad10
Name: eukaryotic translation initiation factor 1A domain containing 10
Synonyms: Gm8332
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 666862
VEGA: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 40,718,997 bp
  • T to A, chromosome 1 at 46,109,302 bp
  • C to A, chromosome 1 at 73,952,477 bp
  • T to A, chromosome 1 at 180,065,081 bp
  • T to C, chromosome 1 at 188,784,708 bp
  • A to G, chromosome 1 at 191,340,868 bp
  • A to T, chromosome 2 at 37,331,759 bp
  • A to G, chromosome 2 at 67,510,573 bp
  • T to A, chromosome 2 at 158,531,925 bp
  • T to C, chromosome 3 at 8,554,865 bp
  • A to G, chromosome 3 at 95,501,614 bp
  • A to G, chromosome 4 at 46,170,015 bp
  • C to T, chromosome 4 at 58,097,424 bp
  • A to C, chromosome 4 at 84,979,340 bp
  • A to G, chromosome 4 at 135,217,205 bp
  • A to G, chromosome 4 at 141,951,491 bp
  • T to C, chromosome 5 at 74,685,690 bp
  • T to C, chromosome 6 at 57,660,122 bp
  • C to T, chromosome 6 at 128,710,087 bp
  • T to A, chromosome 7 at 29,894,796 bp
  • T to A, chromosome 8 at 43,570,153 bp
  • T to C, chromosome 8 at 61,975,792 bp
  • T to A, chromosome 8 at 79,655,864 bp
  • A to T, chromosome 9 at 57,929,769 bp
  • C to A, chromosome 9 at 66,416,347 bp
  • A to G, chromosome 9 at 79,631,643 bp
  • A to T, chromosome 9 at 123,779,306 bp
  • T to A, chromosome 10 at 33,909,033 bp
  • C to T, chromosome 10 at 39,836,722 bp
  • T to C, chromosome 10 at 80,333,793 bp
  • A to T, chromosome 10 at 107,382,691 bp
  • A to T, chromosome 11 at 49,215,076 bp
  • A to G, chromosome 11 at 58,147,928 bp
  • A to G, chromosome 11 at 74,196,207 bp
  • A to G, chromosome 11 at 95,378,834 bp
  • A to G, chromosome 11 at 99,908,432 bp
  • A to T, chromosome 11 at 108,014,344 bp
  • A to G, chromosome 11 at 120,689,039 bp
  • A to G, chromosome 11 at 120,813,419 bp
  • T to C, chromosome 12 at 88,249,754 bp
  • T to A, chromosome 12 at 104,217,266 bp
  • T to C, chromosome 13 at 19,658,829 bp
  • T to C, chromosome 13 at 37,931,572 bp
  • A to G, chromosome 13 at 46,429,207 bp
  • C to T, chromosome 13 at 80,889,093 bp
  • T to C, chromosome 14 at 16,416,620 bp
  • A to T, chromosome 14 at 45,135,867 bp
  • A to G, chromosome 14 at 55,594,361 bp
  • A to G, chromosome 14 at 65,613,526 bp
  • A to T, chromosome 14 at 75,200,431 bp
  • CAAAACAGAAAACAGAAAAC to CAAAACAGAAAACAGAAAACAGAAAAC, chromosome 14 at 76,111,974 bp
  • A to C, chromosome 15 at 8,153,696 bp
  • T to C, chromosome 15 at 25,941,040 bp
  • T to A, chromosome 15 at 28,246,232 bp
  • T to A, chromosome 16 at 23,157,582 bp
  • C to T, chromosome 16 at 38,828,091 bp
  • A to G, chromosome 16 at 97,951,877 bp
  • C to A, chromosome 17 at 20,570,384 bp
  • C to G, chromosome 17 at 26,438,746 bp
  • T to C, chromosome 17 at 42,711,372 bp
  • T to C, chromosome 18 at 37,491,696 bp
  • T to C, chromosome 18 at 74,701,446 bp
  • A to G, chromosome 19 at 5,677,182 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7670 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045742-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.