Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7670Btlr/Mmmh
Stock Number:
045742-MU
Citation ID:
RRID:MMRRC_045742-MU
Other Names:
R7670 (G1)
Major Collection:

Strain Information

Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Fam117a
Name: family with sequence similarity 117, member A
Synonyms: 5730593F17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215512
Homologene: 12775
Aspscr1
Name: ASPSCR1 tether for SLC2A4, UBX domain containing
Synonyms: ASPCR1, RCC17, ASPC, 1190006K01Rik, TUG, ASPL
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68938
Homologene: 41550
Ncbp1
Name: nuclear cap binding protein subunit 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433702
HGNC: HGNC:7658
Homologene: 1859
Clic4
Name: chloride intracellular channel 4
Synonyms: mtCLIC, mc3s5, D0Jmb3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29876
Homologene: 8490
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 40,718,997 bp
  • T to A, chromosome 1 at 46,109,302 bp
  • C to A, chromosome 1 at 73,952,477 bp
  • T to A, chromosome 1 at 180,065,081 bp
  • T to C, chromosome 1 at 188,784,708 bp
  • A to G, chromosome 1 at 191,340,868 bp
  • A to T, chromosome 2 at 37,331,759 bp
  • A to G, chromosome 2 at 67,510,573 bp
  • T to A, chromosome 2 at 158,531,925 bp
  • T to C, chromosome 3 at 8,554,865 bp
  • A to G, chromosome 3 at 95,501,614 bp
  • A to G, chromosome 4 at 46,170,015 bp
  • C to T, chromosome 4 at 58,097,424 bp
  • A to C, chromosome 4 at 84,979,340 bp
  • A to G, chromosome 4 at 135,217,205 bp
  • A to G, chromosome 4 at 141,951,491 bp
  • T to C, chromosome 5 at 74,685,690 bp
  • T to C, chromosome 6 at 57,660,122 bp
  • C to T, chromosome 6 at 128,710,087 bp
  • T to A, chromosome 7 at 29,894,796 bp
  • T to A, chromosome 8 at 43,570,153 bp
  • T to C, chromosome 8 at 61,975,792 bp
  • T to A, chromosome 8 at 79,655,864 bp
  • A to T, chromosome 9 at 57,929,769 bp
  • C to A, chromosome 9 at 66,416,347 bp
  • A to G, chromosome 9 at 79,631,643 bp
  • A to T, chromosome 9 at 123,779,306 bp
  • T to A, chromosome 10 at 33,909,033 bp
  • C to T, chromosome 10 at 39,836,722 bp
  • T to C, chromosome 10 at 80,333,793 bp
  • A to T, chromosome 10 at 107,382,691 bp
  • A to T, chromosome 11 at 49,215,076 bp
  • A to G, chromosome 11 at 58,147,928 bp
  • A to G, chromosome 11 at 74,196,207 bp
  • A to G, chromosome 11 at 95,378,834 bp
  • A to G, chromosome 11 at 99,908,432 bp
  • A to T, chromosome 11 at 108,014,344 bp
  • A to G, chromosome 11 at 120,689,039 bp
  • A to G, chromosome 11 at 120,813,419 bp
  • T to C, chromosome 12 at 88,249,754 bp
  • T to A, chromosome 12 at 104,217,266 bp
  • T to C, chromosome 13 at 19,658,829 bp
  • T to C, chromosome 13 at 37,931,572 bp
  • A to G, chromosome 13 at 46,429,207 bp
  • C to T, chromosome 13 at 80,889,093 bp
  • T to C, chromosome 14 at 16,416,620 bp
  • A to T, chromosome 14 at 45,135,867 bp
  • A to G, chromosome 14 at 55,594,361 bp
  • A to G, chromosome 14 at 65,613,526 bp
  • A to T, chromosome 14 at 75,200,431 bp
  • CAAAACAGAAAACAGAAAAC to CAAAACAGAAAACAGAAAACAGAAAAC, chromosome 14 at 76,111,974 bp
  • A to C, chromosome 15 at 8,153,696 bp
  • T to C, chromosome 15 at 25,941,040 bp
  • T to A, chromosome 15 at 28,246,232 bp
  • T to A, chromosome 16 at 23,157,582 bp
  • C to T, chromosome 16 at 38,828,091 bp
  • A to G, chromosome 16 at 97,951,877 bp
  • C to A, chromosome 17 at 20,570,384 bp
  • C to G, chromosome 17 at 26,438,746 bp
  • T to C, chromosome 17 at 42,711,372 bp
  • T to C, chromosome 18 at 37,491,696 bp
  • T to C, chromosome 18 at 74,701,446 bp
  • A to G, chromosome 19 at 5,677,182 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7670 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045742-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.