Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7706Btlr/Mmmh
Stock Number:
045767-MU
Citation ID:
RRID:MMRRC_045767-MU
Other Names:
R7706 (G1)
Major Collection:

Strain Information

Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Hcn2
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 2
Synonyms: HAC1, trls
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15166
HGNC: HGNC:4846
Homologene: 31022
Ppp2r3c
Name: protein phosphatase 2, regulatory subunit B'', gamma
Synonyms: 5730412A08Rik, G4-1, G5pr, 4930511A21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 59032
VEGA: 12
Homologene: 9915
Srr
Name: serine racemase
Synonyms: M100034, Rgsc34
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27364
Homologene: 22775
Dmtf1
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23857
Homologene: 8017
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Parn
Name: poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms: DAN, 1200003I18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74108
VEGA: 16
HGNC: HGNC:8609
Homologene: 31098
Ddx6
Name: DEAD-box helicase 6
Synonyms: mRCK/P54, HLR2, E230023J21Rik, p54, rck, 1110001P04Rik, C430015D01Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13209
VEGA: 9
HGNC: HGNC:2747
Homologene: 3238
Cnot10
Name: CCR4-NOT transcription complex, subunit 10
Synonyms: 2600001P13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78893
VEGA: 9
Homologene: 41040
Sucla2
Name: succinate-Coenzyme A ligase, ADP-forming, beta subunit
Synonyms: 4930547K18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20916
Homologene: 2856
Kctd17
Name: potassium channel tetramerisation domain containing 17
Synonyms: 2900008M13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72844
Homologene: 23468
Sars1
Name: seryl-tRNA synthetase 1
Synonyms: Strs, Sars
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20226
Homologene: 4751
Dnaaf5
Name: dynein, axonemal assembly factor 5
Synonyms: Heatr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433956
Homologene: 41198
Cir1
Name: corepressor interacting with RBPJ, 1
Synonyms: 2810021A19Rik, CIR, 1700023B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66935
Homologene: 3589
Ybx1
Name: Y box protein 1
Synonyms: MSY1, DNA binding protein B, Nsep1, dbpB, EF1A, YB-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22608
HGNC: HGNC:8014
Homologene: 88707
Arhgef1
Name: Rho guanine nucleotide exchange factor 1
Synonyms: Lsc, Lbcl2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16801
HGNC: HGNC:681
Homologene: 3454
Pcdh20
Name: protocadherin 20
Synonyms: PCDH13, C630015B17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219257
Homologene: 11277
Steap2
Name: six transmembrane epithelial antigen of prostate 2
Synonyms: 4921538B17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74051
Homologene: 17682
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4921518A06Rik, 4933421G18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72205
Homologene: 8125
Fnip1
Name: folliculin interacting protein 1
Synonyms: A730024A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216742
Homologene: 28173
Klhl20
Name: kelch-like 20
Synonyms: D930050H05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226541
Homologene: 8699
Ift172
Name: intraflagellar transport 172
Synonyms: wim, 4930553F24Rik, avc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67661
Homologene: 15202
Chst10
Name: carbohydrate sulfotransferase 10
Synonyms: ST, Hnk-1st
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98388
Homologene: 21013
Dennd6b
Name: DENN domain containing 6B
Synonyms: 1700027J05Rik, Fam116b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69440
VEGA: 15
Homologene: 57065
Tubgcp6
Name: tubulin, gamma complex component 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328580
Homologene: 32477
Irs1
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16367
HGNC: HGNC:6125
Homologene: 4049
Mug5
Name: murinoglobulin 5
Synonyms: Gm7298
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 640530
HGNC: HGNC:9750
Slc13a4
Name: solute carrier family 13 (sodium/sulfate symporters), member 4
Synonyms: SUT-1, SUT1, 9630060C05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243755
Homologene: 69125
Ciao3
Name: cytosolic iron-sulfur assembly component 3
Synonyms: 9030612I22Rik, Narfl
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67563
Homologene: 6750
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64899
Homologene: 84844
B4galnt3
Name: beta-1,4-N-acetyl-galactosaminyl transferase 3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330406
Homologene: 18328
Uevld
Name: UEV and lactate/malate dehyrogenase domains
Synonyms: 8430408E05Rik, Attp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54122
Homologene: 69251
C9
Name: complement component 9
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12279
HGNC: HGNC:1358
Homologene: 74406
Dzip1l
Name: DAZ interacting protein 1-like
Synonyms: 2610524A10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72507
Homologene: 12466
Lrrc38
Name: leucine rich repeat containing 38
Synonyms: A230053A07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242735
Homologene: 77949
Tha1
Name: threonine aldolase 1
Synonyms: GLY1, 1300017K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71776
Homologene: 57081
Krt1
Name: keratin 1
Synonyms: Krt2-1, Krt-2.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Samm50
Name: SAMM50 sorting and assembly machinery component
Synonyms: 1110030L07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68653
VEGA: 15
Homologene: 41034
Atxn7l2
Name: ataxin 7-like 2
Synonyms: 2610528J18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72522
Homologene: 17728
1600014C23Rik
Name: RIKEN cDNA 1600014C23 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72240
VEGA: 17
Trim56
Name: tripartite motif-containing 56
Synonyms: LOC384309, RNF109, A130009K11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384309
Homologene: 12812
Ly6e
Name: lymphocyte antigen 6 family member E
Synonyms: Sca-2, Ly67, Tsa1, 9804, RIG-E, TSA-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17069
HGNC: HGNC:6727
Homologene: 56411
Or52k2
Name: olfactory receptor family 52 subfamily K member 2
Synonyms: GA_x6K02T2PBJ9-5323062-5324015, MOR28-1, Olfr552
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259106
Homologene: 73941
Zfp36l2
Name: zinc finger protein 36, C3H type-like 2
Synonyms: Tis11d, ERF2, Brf2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12193
HGNC: HGNC:1108
Homologene: 5027
Zfp354b
Name: zinc finger protein 354B
Synonyms: Kid2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27274
Homologene: 32187
Cish
Name: cytokine inducible SH2-containing protein
Synonyms: F23, Cis, cytokine-inducible SH2 protein, CIS1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12700
HGNC: HGNC:1984
Homologene: 7667
Efcab8
Name: EF-hand calcium binding domain 8
Synonyms: EG329541
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100504221
Senp8
Name: SUMO peptidase family member, NEDD8 specific
Synonyms: Nedp1, Den1, 9130010J17Rik, Prsc2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71599
VEGA: 9
Homologene: 14084
Pcmtd2
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
Synonyms: 5330414D10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245867
Homologene: 10099
Lalba
Name: lactalbumin, alpha
Synonyms: lactalbumin alpha
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16770
VEGA: 15
HGNC: HGNC:6480
Homologene: 1720
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 38,866,025 bp
  • A to G, chromosome 1 at 82,287,691 bp
  • T to C, chromosome 1 at 161,109,257 bp
  • A to G, chromosome 2 at 73,312,479 bp
  • T to A, chromosome 2 at 153,781,775 bp
  • T to C, chromosome 2 at 160,905,290 bp
  • C to T, chromosome 2 at 181,855,075 bp
  • T to C, chromosome 3 at 108,207,403 bp
  • C to T, chromosome 3 at 108,431,464 bp
  • A to G, chromosome 4 at 119,278,967 bp
  • G to A, chromosome 4 at 143,350,275 bp
  • T to A, chromosome 5 at 5,682,967 bp
  • T to A, chromosome 5 at 9,124,489 bp
  • C to T, chromosome 5 at 31,266,379 bp
  • T to C, chromosome 5 at 137,114,656 bp
  • T to C, chromosome 5 at 139,152,841 bp
  • T to C, chromosome 6 at 35,270,355 bp
  • C to A, chromosome 6 at 120,218,952 bp
  • T to A, chromosome 6 at 121,735,611 bp
  • T to A, chromosome 7 at 19,186,110 bp
  • G to A, chromosome 7 at 24,916,881 bp
  • A to G, chromosome 7 at 46,948,027 bp
  • T to C, chromosome 7 at 49,594,319 bp
  • T to A, chromosome 7 at 102,604,646 bp
  • A to G, chromosome 9 at 44,627,642 bp
  • A to G, chromosome 9 at 59,737,838 bp
  • A to T, chromosome 9 at 99,637,536 bp
  • G to A, chromosome 9 at 107,300,641 bp
  • A to T, chromosome 9 at 114,593,438 bp
  • G to A, chromosome 10 at 79,734,183 bp
  • C to T, chromosome 11 at 50,928,563 bp
  • A to T, chromosome 11 at 54,515,499 bp
  • T to G, chromosome 11 at 74,913,135 bp
  • T to C, chromosome 11 at 94,415,041 bp
  • T to C, chromosome 11 at 117,869,455 bp
  • A to G, chromosome 12 at 55,281,705 bp
  • T to A, chromosome 13 at 67,623,493 bp
  • A to G, chromosome 14 at 73,568,993 bp
  • A to G, chromosome 14 at 88,467,357 bp
  • T to A, chromosome 15 at 6,458,921 bp
  • T to C, chromosome 15 at 8,351,526 bp
  • T to C, chromosome 15 at 74,958,334 bp
  • CAGCTGGAGGAGC to CAGC, chromosome 15 at 78,436,913 bp
  • T to A, chromosome 15 at 84,200,880 bp
  • T to A, chromosome 15 at 89,104,223 bp
  • T to C, chromosome 15 at 89,185,244 bp
  • T to C, chromosome 15 at 98,481,593 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • T to C, chromosome 16 at 13,607,253 bp
  • T to C, chromosome 17 at 25,782,252 bp
  • A to G, chromosome 17 at 25,964,151 bp
  • G to A, chromosome 17 at 45,733,657 bp
  • A to T, chromosome 17 at 84,186,918 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7706 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045767-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.