Strain Name:
C57BL/6J-MtgxR7709Btlr/Mmmh
Stock Number:
045768-MU
Citation ID:
RRID:MMRRC_045768-MU
Other Names:
R7709 (G1)
Major Collection:

Strain Information

Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, MYH-beta/slow, beta-MHC, B-MHC, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Npy2r
Name: neuropeptide Y receptor Y2
Synonyms: NPY-Y2 receptor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18167
HGNC: HGNC:7957
Homologene: 701
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Etv5
Name: ets variant 5
Synonyms: 8430401F14Rik, erm, 1110005E01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104156
HGNC: HGNC:3494
Homologene: 3276
Ctbp2
Name: C-terminal binding protein 2
Synonyms: Ribeye, D7Ertd45e, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Ylpm1
Name: YLP motif containing 1
Synonyms: ZAP, Zap3, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Lrrc59
Name: leucine rich repeat containing 59
Synonyms: C78668
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 98238
Homologene: 10229
Wdr47
Name: WD repeat domain 47
Synonyms: 1810073M12Rik, nemitin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99512
Homologene: 8984
Dock5
Name: dedicator of cytokinesis 5
Synonyms: lr2, 1110060D06Rik, rlc
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68813
VEGA: 14
Homologene: 57016
Rps6kb1
Name: ribosomal protein S6 kinase, polypeptide 1
Synonyms: p70/85s6k, p70s6k, S6K1, 2610318I15Rik, p70S6K1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72508
Homologene: 81703
Gart
Name: phosphoribosylglycinamide formyltransferase
Synonyms: Gaps, Prgs
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14450
HGNC: HGNC:4163
Homologene: 637
Hmgcr
Name: 3-hydroxy-3-methylglutaryl-Coenzyme A reductase
Synonyms: HMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15357
HGNC: HGNC:5006
Homologene: 30994
Mtmr12
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268783
Homologene: 10403
Mrps27
Name: mitochondrial ribosomal protein S27
Synonyms: 2610028H14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218506
VEGA: 13
Homologene: 41006
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Rabgap1
Name: RAB GTPase activating protein 1
Synonyms: Gapcena
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227800
Homologene: 49301
Cap1
Name: cyclase associated actin cytoskeleton regulatory protein 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12331
Homologene: 74572
Abcg8
Name: ATP binding cassette subfamily G member 8
Synonyms: 1300003C16Rik, Sterolin-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67470
Homologene: 23361
Arl5a
Name: ADP-ribosylation factor-like 5A
Synonyms: 2410015N24Rik, 2810410P22Rik, Arl5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75423
HGNC: HGNC:696
Homologene: 100572
Adgrl1
Name: adhesion G protein-coupled receptor L1
Synonyms: Lec2, lectomedin-2, 2900070I05Rik, Lphn1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330814
Homologene: 8951
Dab1
Name: disabled 1
Synonyms: C630028C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13131
HGNC: HGNC:2661
Homologene: 32084
Gucy1a1
Name: guanylate cyclase 1, soluble, alpha 1
Synonyms: alpha 1 sGC, 1200016O07Rik, sGC-alpha1, Gucy1a3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 60596
HGNC: HGNC:4685
Homologene: 37360
Gpr3
Name: G-protein coupled receptor 3
Synonyms: Gpcr21, Gpcr3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14748
HGNC: HGNC:4484
Homologene: 31303
Ptk7
Name: PTK7 protein tyrosine kinase 7
Synonyms: 8430404F20Rik, mPTK7/CCK4, chz
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71461
VEGA: 17
HGNC: HGNC:9618
Homologene: 43672
Zfp992
Name: zinc finger protein 992
Synonyms: Gm13251
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433791
Homologene: 133076
Src
Name: Rous sarcoma oncogene
Synonyms: pp60c-src
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20779
Homologene: 21120
Ift81
Name: intraflagellar transport 81
Synonyms: CDV-1R, Cdv1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12589
Homologene: 7664
Zfp148
Name: zinc finger protein 148
Synonyms: beta enolase repressor factor 1, BERF-1, BFCOL1, 2210405J08Rik, ZBP-89
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22661
VEGA: 16
Homologene: 8003
Ccdc25
Name: coiled-coil domain containing 25
Synonyms: 2610528H13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67179
VEGA: 14
Homologene: 6645
Mon1a
Name: MON1 homolog A, secretory traffciking associated
Synonyms: 2810468K17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72825
Homologene: 7191
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 4732496O19Rik, 6530407C02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99470
Homologene: 26431
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Zp2
Name: zona pellucida glycoprotein 2
Synonyms: Zp-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22787
Homologene: 48194
Clec4b2
Name: C-type lectin domain family 4, member b2
Synonyms: mDCAR1, F830043G12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381809
Homologene: 128249
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Tpo
Name: thyroid peroxidase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22018
Homologene: 461
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f, Myhs-f1, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Taar2
Name: trace amine-associated receptor 2
Synonyms: Gpr58
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209512
HGNC: HGNC:4514
Homologene: 110760
Or8c20
Name: olfactory receptor family 8 subfamily C member 20
Synonyms: GA_x6K02T2PVTD-32037624-32038565, MOR170-3, Olfr898
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258871
VEGA: 9
Homologene: 133654
Coq8b
Name: coenzyme Q8B
Synonyms: 0610012P18Rik, Adck4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76889
Homologene: 86731
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Aox3
Name: aldehyde oxidase 3
Synonyms: AOH1, 1200011D03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71724
Homologene: 90899
Or4c10
Name: olfactory receptor family 4 subfamily C member 10
Synonyms: GA_x6K02T2Q125-51361752-51362687, MOR232-3, Olfr1258
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258980
Homologene: 82299
Il10ra
Name: interleukin 10 receptor, alpha
Synonyms: mIL-10R, Il10r, CDw210
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16154
HGNC: HGNC:5964
Homologene: 1196
Ina
Name: internexin neuronal intermediate filament protein, alpha
Synonyms: NF-66, NF66
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226180
HGNC: HGNC:6057
Homologene: 10433
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Dgkz
Name: diacylglycerol kinase zeta
Synonyms: mDGK[z], E130307B02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104418
HGNC: HGNC:2857
Homologene: 37831
Vil1
Name: villin 1
Synonyms: Villin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22349
Homologene: 5169
4933415A04Rik
Name: RIKEN cDNA 4933415A04 gene
Type: Gene
Species: Mouse
Chromosome: 11
Prss39
Name: serine protease 39
Synonyms: Tesp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21755
Homologene: 84781
Cyp2d22
Name: cytochrome P450, family 2, subfamily d, polypeptide 22
Synonyms: 2D22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56448
VEGA: 15
Homologene: 75003
Fdps
Name: farnesyl diphosphate synthetase
Synonyms: Fdpsl1, 6030492I17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110196
HGNC: HGNC:3631
Homologene: 1519
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Dhx34
Name: DExH-box helicase 34
Synonyms: Ddx34, 1200013B07Rik, 1810012L18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71723
Homologene: 69171
Sardh
Name: sarcosine dehydrogenase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192166
Homologene: 5149
Ano8
Name: anoctamin 8
Synonyms: Tmem16h
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382014
Homologene: 124473
Acan
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Txk
Name: TXK tyrosine kinase
Synonyms: Rlk, Btkl, PTK4, A130089B16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22165
Homologene: 2497
Or2t1
Name: olfactory receptor family 2 subfamily T member 1
Synonyms: MTPCR53, MOR274-1, GA_x6K02T2PLTE-6714644-6715597, Olfr31
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18330
HGNC: HGNC:8277
Homologene: 74028
Ace
Name: angiotensin I converting enzyme
Synonyms: CD143
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11421
HGNC: HGNC:2707
Homologene: 37351
Baiap2l2
Name: BAI1-associated protein 2-like 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 207495
Homologene: 11811
Redic1
Name: regulator of DNA class I crossover intermediates 1
Synonyms: Gm5807, CN725425
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545126
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Gpsm2
Name: G-protein signalling modulator 2 (AGS3-like, C. elegans)
Synonyms: Pins, 6230410J09Rik, LGN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76123
Homologene: 56584
Ocln
Name: occludin
Synonyms: Ocl
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18260
HGNC: HGNC:8104
Homologene: 1905
Gm572
Name: predicted gene 572
Synonyms: LOC230909, b2b1167Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230909
Homologene: 52134
Heatr4
Name: HEAT repeat containing 4
Synonyms: Gm17673
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 101055670
Homologene: 45728
Sebox
Name: SEBOX homeobox
Synonyms: OG9, Og9x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18292
Homologene: 32052
Spink8
Name: serine peptidase inhibitor, Kazal type 8
Synonyms: C630041L24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78709
Homologene: 18834
Lce1i
Name: late cornified envelope 1I
Synonyms: 2310069N01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76585
Rogdi
Name: rogdi homolog
Synonyms: 0610011C19Rik, Lzf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66049
Homologene: 11605
Mmaa
Name: methylmalonic aciduria (cobalamin deficiency) type A
Synonyms: 2810018E08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109136
Homologene: 14586
Zfp994
Name: zinc finger protein 994
Synonyms: Gm4944
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240038
VEGA: 17
Homologene: 133246
B3galt9
Name: beta-1,3-galactosyltransferase 9
Synonyms: Gm34653
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102637973
Homologene: 131655
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,502,628 bp
  • T to C, chromosome 1 at 58,180,651 bp
  • T to C, chromosome 1 at 71,335,728 bp
  • C to T, chromosome 1 at 74,426,595 bp
  • T to G, chromosome 1 at 133,079,841 bp
  • T to C, chromosome 1 at 181,702,484 bp
  • T to A, chromosome 2 at 27,241,517 bp
  • T to G, chromosome 2 at 34,838,425 bp
  • T to C, chromosome 2 at 37,537,327 bp
  • T to C, chromosome 2 at 52,405,056 bp
  • T to C, chromosome 2 at 89,929,881 bp
  • T to C, chromosome 2 at 91,937,059 bp
  • C to A, chromosome 2 at 153,672,220 bp
  • G to A, chromosome 2 at 157,457,244 bp
  • G to T, chromosome 3 at 59,331,543 bp
  • T to C, chromosome 3 at 82,094,789 bp
  • T to C, chromosome 3 at 82,540,382 bp
  • A to G, chromosome 3 at 89,101,090 bp
  • A to T, chromosome 3 at 92,777,759 bp
  • A to G, chromosome 3 at 104,034,038 bp
  • G to T, chromosome 3 at 108,618,521 bp
  • A to G, chromosome 3 at 108,701,781 bp
  • A to G, chromosome 3 at 124,407,685 bp
  • A to G, chromosome 4 at 73,942,854 bp
  • C to A, chromosome 4 at 104,720,559 bp
  • A to T, chromosome 4 at 122,862,674 bp
  • A to T, chromosome 4 at 133,210,437 bp
  • A to T, chromosome 4 at 146,467,165 bp
  • C to T, chromosome 4 at 148,668,951 bp
  • T to C, chromosome 5 at 72,707,575 bp
  • C to T, chromosome 5 at 122,609,331 bp
  • A to C, chromosome 6 at 121,660,104 bp
  • A to G, chromosome 6 at 123,173,015 bp
  • G to A, chromosome 7 at 16,212,864 bp
  • T to C, chromosome 7 at 25,538,651 bp
  • T to C, chromosome 7 at 27,250,537 bp
  • G to T, chromosome 7 at 79,089,608 bp
  • A to T, chromosome 7 at 120,135,775 bp
  • C to A, chromosome 7 at 132,990,060 bp
  • C to T, chromosome 7 at 142,165,647 bp
  • A to G, chromosome 8 at 41,054,650 bp
  • T to C, chromosome 8 at 71,482,289 bp
  • T to A, chromosome 8 at 79,269,201 bp
  • G to A, chromosome 8 at 83,938,988 bp
  • A to G, chromosome 9 at 38,349,277 bp
  • A to G, chromosome 9 at 45,260,399 bp
  • G to T, chromosome 9 at 107,900,128 bp
  • G to A, chromosome 9 at 109,816,780 bp
  • A to G, chromosome 10 at 23,940,723 bp
  • A to T, chromosome 10 at 81,879,494 bp
  • A to C, chromosome 10 at 82,290,532 bp
  • GTGTGTGTGTATGTGTGTGT to GTGTGTGTGT, chromosome 11 at 43,587,410 bp
  • T to C, chromosome 11 at 67,194,864 bp
  • A to G, chromosome 11 at 78,504,093 bp
  • A to T, chromosome 11 at 86,513,322 bp
  • A to T, chromosome 11 at 94,634,985 bp
  • T to G, chromosome 11 at 101,556,241 bp
  • A to G, chromosome 11 at 105,346,459 bp
  • G to A, chromosome 11 at 105,988,837 bp
  • A to T, chromosome 12 at 30,131,860 bp
  • G to A, chromosome 12 at 71,977,649 bp
  • A to T, chromosome 12 at 83,957,725 bp
  • C to T, chromosome 12 at 85,013,025 bp
  • A to G, chromosome 13 at 96,663,097 bp
  • T to A, chromosome 13 at 99,404,996 bp
  • T to A, chromosome 13 at 100,539,598 bp
  • T to A, chromosome 14 at 12,226,452 bp
  • T to C, chromosome 14 at 14,328,384 bp
  • C to G, chromosome 14 at 54,988,801 bp
  • A to T, chromosome 14 at 65,840,484 bp
  • A to G, chromosome 14 at 67,796,005 bp
  • T to A, chromosome 15 at 12,245,011 bp
  • G to A, chromosome 15 at 37,979,832 bp
  • G to T, chromosome 15 at 79,259,711 bp
  • A to G, chromosome 15 at 82,374,411 bp
  • C to A, chromosome 15 at 91,240,727 bp
  • A to G, chromosome 16 at 5,009,234 bp
  • A to T, chromosome 16 at 22,412,847 bp
  • T to A, chromosome 16 at 33,468,175 bp
  • A to G, chromosome 16 at 91,622,965 bp
  • T to C, chromosome 17 at 22,200,425 bp
  • T to A, chromosome 17 at 46,571,643 bp
  • A to T, chromosome 17 at 57,402,519 bp
  • A to T, chromosome 17 at 71,358,198 bp
  • A to T, chromosome 17 at 84,692,491 bp
  • A to T, chromosome 19 at 47,023,643 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7709 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045768-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.