Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7709Btlr/Mmmh
Stock Number:
045768-MU
Citation ID:
RRID:MMRRC_045768-MU
Other Names:
R7709 (G1)
Major Collection:

Strain Information

Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Npy2r
Name: neuropeptide Y receptor Y2
Synonyms: NPY-Y2 receptor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18167
HGNC: HGNC:7957
Homologene: 701
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Etv5
Name: ets variant 5
Synonyms: 8430401F14Rik, erm, 1110005E01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104156
HGNC: HGNC:3494
Homologene: 3276
Ctbp2
Name: C-terminal binding protein 2
Synonyms: D7Ertd45e, Ribeye, Gtrgeo6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13017
HGNC: HGNC:2495
Homologene: 75187
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,502,628 bp
  • T to C, chromosome 1 at 58,180,651 bp
  • T to C, chromosome 1 at 71,335,728 bp
  • C to T, chromosome 1 at 74,426,595 bp
  • T to G, chromosome 1 at 133,079,841 bp
  • T to C, chromosome 1 at 181,702,484 bp
  • T to A, chromosome 2 at 27,241,517 bp
  • T to G, chromosome 2 at 34,838,425 bp
  • T to C, chromosome 2 at 37,537,327 bp
  • T to C, chromosome 2 at 52,405,056 bp
  • T to C, chromosome 2 at 89,929,881 bp
  • T to C, chromosome 2 at 91,937,059 bp
  • C to A, chromosome 2 at 153,672,220 bp
  • G to A, chromosome 2 at 157,457,244 bp
  • G to T, chromosome 3 at 59,331,543 bp
  • T to C, chromosome 3 at 82,094,789 bp
  • T to C, chromosome 3 at 82,540,382 bp
  • A to G, chromosome 3 at 89,101,090 bp
  • A to T, chromosome 3 at 92,777,759 bp
  • A to G, chromosome 3 at 104,034,038 bp
  • G to T, chromosome 3 at 108,618,521 bp
  • A to G, chromosome 3 at 108,701,781 bp
  • A to G, chromosome 3 at 124,407,685 bp
  • A to G, chromosome 4 at 73,942,854 bp
  • C to A, chromosome 4 at 104,720,559 bp
  • A to T, chromosome 4 at 122,862,674 bp
  • A to T, chromosome 4 at 133,210,437 bp
  • A to T, chromosome 4 at 146,467,165 bp
  • C to T, chromosome 4 at 148,668,951 bp
  • T to C, chromosome 5 at 72,707,575 bp
  • C to T, chromosome 5 at 122,609,331 bp
  • A to C, chromosome 6 at 121,660,104 bp
  • A to G, chromosome 6 at 123,173,015 bp
  • G to A, chromosome 7 at 16,212,864 bp
  • T to C, chromosome 7 at 25,538,651 bp
  • T to C, chromosome 7 at 27,250,537 bp
  • G to T, chromosome 7 at 79,089,608 bp
  • A to T, chromosome 7 at 120,135,775 bp
  • C to A, chromosome 7 at 132,990,060 bp
  • C to T, chromosome 7 at 142,165,647 bp
  • A to G, chromosome 8 at 41,054,650 bp
  • T to C, chromosome 8 at 71,482,289 bp
  • T to A, chromosome 8 at 79,269,201 bp
  • G to A, chromosome 8 at 83,938,988 bp
  • A to G, chromosome 9 at 38,349,277 bp
  • A to G, chromosome 9 at 45,260,399 bp
  • G to T, chromosome 9 at 107,900,128 bp
  • G to A, chromosome 9 at 109,816,780 bp
  • A to G, chromosome 10 at 23,940,723 bp
  • A to T, chromosome 10 at 81,879,494 bp
  • A to C, chromosome 10 at 82,290,532 bp
  • GTGTGTGTGTATGTGTGTGT to GTGTGTGTGT, chromosome 11 at 43,587,410 bp
  • T to C, chromosome 11 at 67,194,864 bp
  • A to G, chromosome 11 at 78,504,093 bp
  • A to T, chromosome 11 at 86,513,322 bp
  • A to T, chromosome 11 at 94,634,985 bp
  • T to G, chromosome 11 at 101,556,241 bp
  • A to G, chromosome 11 at 105,346,459 bp
  • G to A, chromosome 11 at 105,988,837 bp
  • A to T, chromosome 12 at 30,131,860 bp
  • G to A, chromosome 12 at 71,977,649 bp
  • A to T, chromosome 12 at 83,957,725 bp
  • C to T, chromosome 12 at 85,013,025 bp
  • A to G, chromosome 13 at 96,663,097 bp
  • T to A, chromosome 13 at 99,404,996 bp
  • T to A, chromosome 13 at 100,539,598 bp
  • T to A, chromosome 14 at 12,226,452 bp
  • T to C, chromosome 14 at 14,328,384 bp
  • C to G, chromosome 14 at 54,988,801 bp
  • A to T, chromosome 14 at 65,840,484 bp
  • A to G, chromosome 14 at 67,796,005 bp
  • T to A, chromosome 15 at 12,245,011 bp
  • G to A, chromosome 15 at 37,979,832 bp
  • G to T, chromosome 15 at 79,259,711 bp
  • A to G, chromosome 15 at 82,374,411 bp
  • C to A, chromosome 15 at 91,240,727 bp
  • A to G, chromosome 16 at 5,009,234 bp
  • A to T, chromosome 16 at 22,412,847 bp
  • T to A, chromosome 16 at 33,468,175 bp
  • A to G, chromosome 16 at 91,622,965 bp
  • T to C, chromosome 17 at 22,200,425 bp
  • T to A, chromosome 17 at 46,571,643 bp
  • A to T, chromosome 17 at 57,402,519 bp
  • A to T, chromosome 17 at 71,358,198 bp
  • A to T, chromosome 17 at 84,692,491 bp
  • A to T, chromosome 19 at 47,023,643 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7709 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045768-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.