Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7716Btlr/Mmmh
Stock Number:
045774-MU
Citation ID:
RRID:MMRRC_045774-MU
Other Names:
R7716 (G1)
Major Collection:

Strain Information

Smco3
Name: single-pass membrane protein with coiled-coil domains 3
Synonyms: C030030A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 654818
Homologene: 79087
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Cpe
Name: carboxypeptidase E
Synonyms: carboxypeptidase H, CPH, Cph1, Cph-1, NF-alpha1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12876
HGNC: HGNC:2303
Homologene: 48052
Strn
Name: striatin, calmodulin binding protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268980
Homologene: 2380
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Creb1
Name: cAMP responsive element binding protein 1
Synonyms: Creb-1, Creb, 2310001E10Rik, 3526402H21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12912
HGNC: HGNC:2345
Homologene: 3223
Tspan14
Name: tetraspanin 14
Synonyms: D14Ertd226e, Tm4sf14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52588
VEGA: 14
Homologene: 23717
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Ndc80
Name: NDC80 kinetochore complex component
Synonyms: HEC1, 2610020P18Rik, Kntc2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67052
VEGA: 17
Homologene: 38141
Klhdc4
Name: kelch domain containing 4
Synonyms: G430025P05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234825
Homologene: 69234
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Emsy
Name: EMSY, BRCA2-interacting transcriptional repressor
Synonyms: 2210018M11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233545
Homologene: 32465
Gnpat
Name: glyceronephosphate O-acyltransferase
Synonyms: D1Ertd819e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14712
HGNC: HGNC:4416
Homologene: 40716
Serpini1
Name: serine (or cysteine) peptidase inhibitor, clade I, member 1
Synonyms: Neuroserpin, PI12, Spi17, Ns
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20713
HGNC: HGNC:8943
Homologene: 21045
Abcg1
Name: ATP binding cassette subfamily G member 1
Synonyms: White, Abc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11307
HGNC: HGNC:73
Homologene: 21022
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Pygo1
Name: pygopus 1
Synonyms: 2600014C22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72135
Homologene: 41050
Unc5b
Name: unc-5 netrin receptor B
Synonyms: 6330415E02Rik, Unc5h2, D10Bwg0792e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 107449
VEGA: 10
Homologene: 32538
Bmp1
Name: bone morphogenetic protein 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12153
VEGA: 14
HGNC: HGNC:1067
Homologene: 55955
Ccdc3
Name: coiled-coil domain containing 3
Synonyms: 2310045O21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74186
Homologene: 12870
Plpp1
Name: phospholipid phosphatase 1
Synonyms: mPAP, Lipid phosphate phosphatase 1, LPP1, LPP-1, Hpic53, Ppap2a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19012
VEGA: 13
HGNC: HGNC:9228
Homologene: 134049
Gclc
Name: glutamate-cysteine ligase, catalytic subunit
Synonyms: gamma GCS-HS, Glclc, GLCL-H, D9Wsu168e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14629
HGNC: HGNC:4311
Homologene: 1148
Zbtb14
Name: zinc finger and BTB domain containing 14
Synonyms: ZF5, Zfp161, b2b1982Clo
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22666
Homologene: 2560
Dnajc1
Name: DnaJ heat shock protein family (Hsp40) member C1
Synonyms: MTJ1, Dnajl1, ERdj1, 4733401K02Rik, D230036H06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13418
Homologene: 7293
Pms1
Name: PMS1 homolog 1, mismatch repair system component
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227099
HGNC: HGNC:9121
Homologene: 449
Mbip
Name: MAP3K12 binding inhibitory protein 1
Synonyms: 4933408E06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217588
VEGA: 12
Homologene: 9576
Edrf1
Name: erythroid differentiation regulatory factor 1
Synonyms: 2700050L05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214764
Homologene: 27985
Ndufs1
Name: NADH:ubiquinone oxidoreductase core subunit S1
Synonyms: 9930026A05Rik, 5830412M15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227197
HGNC: HGNC:7707
Homologene: 3670
Iqcb1
Name: IQ calmodulin-binding motif containing 1
Synonyms: 6820449I09Rik, NPHP5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320299
Homologene: 8766
Trpc7
Name: transient receptor potential cation channel, subfamily C, member 7
Synonyms: TRP7, Trrp8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26946
Homologene: 22689
Prf1
Name: perforin 1 (pore forming protein)
Synonyms: perforin, Prf-1, Pfp, Pfn
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18646
VEGA: 10
HGNC: HGNC:9360
Homologene: 3698
Irak2
Name: interleukin-1 receptor-associated kinase 2
Synonyms: 6330415L08Rik, IRAK-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108960
HGNC: HGNC:6113
Homologene: 1207
Nlrc4
Name: NLR family, CARD domain containing 4
Synonyms: 9530011P19Rik, Card12, Ipaf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268973
VEGA: 17
Homologene: 10924
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Megf10
Name: multiple EGF-like-domains 10
Synonyms: LOC240312, 3000002B06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70417
Homologene: 23771
Lrguk
Name: leucine-rich repeats and guanylate kinase domain containing
Synonyms: 4921528H16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74354
Homologene: 34923
Vmn2r26
Name: vomeronasal 2, receptor 26
Synonyms: V2r1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56552
Homologene: 135915
Or14a258
Name: olfactory receptor family 14 subfamily A member 258
Synonyms: GA_x6K02T2NHDJ-9721756-9722757, MOR219-3P, Olfr304
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258089
Homologene: 121542
Col6a6
Name: collagen, type VI, alpha 6
Synonyms: E330026B02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245026
Homologene: 18260
Atp2a1
Name: ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Synonyms: SERCA1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11937
HGNC: HGNC:811
Homologene: 7635
Plce1
Name: phospholipase C, epsilon 1
Synonyms: 4933403A21Rik, PLCepsilon
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74055
Homologene: 9478
Kansl1l
Name: KAT8 regulatory NSL complex subunit 1-like
Synonyms: C430010P07Rik, 1110028C15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68691
Homologene: 27376
Zfp623
Name: zinc finger protein 623
Synonyms: 2610029D06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78834
VEGA: 15
Homologene: 15994
Usp13
Name: ubiquitin specific peptidase 13 (isopeptidase T-3)
Synonyms: IsoT-3, ISOT3, 2700071E21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72607
Homologene: 68372
Slc29a4
Name: solute carrier family 29 (nucleoside transporters), member 4
Synonyms: ENT4, mPMAT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243328
Homologene: 71345
Sdr42e1
Name: short chain dehydrogenase/reductase family 42E, member 1
Synonyms: 4632417N05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74032
Homologene: 23654
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: ovalbumin, CAP-2, CAP2, Spi8, NK10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Vmn1r230
Name: vomeronasal 1 receptor 230
Synonyms: V1re8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171231
Homologene: 136306
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625131
Homologene: 129606
Pdc
Name: phosducin
Synonyms: Pdc, Rpr-1, Rpr1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20028
HGNC: HGNC:8759
Homologene: 1950
Gpd1
Name: glycerol-3-phosphate dehydrogenase 1 (soluble)
Synonyms: Gdc-1, Gdc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14555
HGNC: HGNC:4455
Homologene: 5593
Cyp4a32
Name: cytochrome P450, family 4, subfamily a, polypeptide 32
Synonyms: OTTMUSG00000008689
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100040843
HGNC: HGNC:2642
Homologene: 128044
1110032F04Rik
Name: RIKEN cDNA 1110032F04 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68725
Homologene: 110165
Or11h6
Name: olfactory receptor family 11 subfamily H member 6
Synonyms: GA_x6K02T2PMLR-6361495-6362481, MOR106-11, Olfr745
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258296
Homologene: 27116
Zfp764l1
Name: zinc finger protein 764 like 1
Synonyms: E430018J23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101604
Homologene: 138471
Marchf5
Name: membrane associated ring-CH-type finger 5
Synonyms: 2310008I22Rik, E130202O05Rik, 1810015H18Rik, MARCH-V, 2700055A20Rik, Rnf153, 5730499H23Rik, MITOL, March5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69104
Homologene: 9862
Lgalsl2
Name: galectin like 2
Synonyms: Gm5065
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 272350
Tmem167b
Name: transmembrane protein 167B
Synonyms: 2010200O16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67495
Homologene: 10594
Sri
Name: sorcin
Synonyms: Sor, 2210417O06Rik, 2900070H08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109552
Homologene: 37736
Cyren
Name: cell cycle regulator of NHEJ
Synonyms: 3110062M04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78412
Homologene: 49745
Asb5
Name: ankyrin repeat and SOCs box-containing 5
Synonyms: 1110018D09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76294
Homologene: 12637
Asnsd1
Name: asparagine synthetase domain containing 1
Synonyms: 2210409M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70396
Homologene: 6564
Eppk1
Name: epiplakin 1
Synonyms: EPIPL1, EPPK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 53,207,608 bp
  • C to T, chromosome 1 at 53,347,743 bp
  • T to C, chromosome 1 at 63,152,857 bp
  • T to A, chromosome 1 at 64,566,261 bp
  • A to G, chromosome 1 at 66,801,133 bp
  • G to A, chromosome 1 at 87,665,399 bp
  • C to T, chromosome 1 at 107,604,708 bp
  • A to C, chromosome 1 at 150,330,783 bp
  • T to A, chromosome 2 at 5,138,302 bp
  • A to G, chromosome 2 at 18,219,873 bp
  • A to G, chromosome 2 at 24,884,499 bp
  • T to A, chromosome 2 at 158,000,698 bp
  • C to A, chromosome 3 at 32,837,856 bp
  • G to A, chromosome 3 at 68,869,829 bp
  • A to C, chromosome 3 at 75,616,714 bp
  • T to C, chromosome 3 at 108,558,897 bp
  • G to T, chromosome 3 at 126,943,166 bp
  • T to A, chromosome 4 at 115,601,086 bp
  • T to A, chromosome 5 at 8,056,641 bp
  • C to T, chromosome 5 at 142,718,506 bp
  • T to A, chromosome 5 at 144,777,146 bp
  • C to T, chromosome 6 at 34,095,539 bp
  • T to C, chromosome 6 at 34,875,581 bp
  • T to C, chromosome 6 at 113,462,969 bp
  • AC to ACC, chromosome 6 at 113,690,898 bp
  • T to A, chromosome 6 at 124,061,745 bp
  • T to A, chromosome 6 at 136,831,249 bp
  • T to C, chromosome 7 at 5,359,820 bp
  • A to T, chromosome 7 at 86,386,054 bp
  • G to A, chromosome 7 at 98,599,766 bp
  • C to A, chromosome 7 at 126,462,187 bp
  • T to A, chromosome 7 at 127,392,087 bp
  • G to A, chromosome 7 at 133,643,726 bp
  • T to A, chromosome 8 at 54,584,986 bp
  • T to C, chromosome 8 at 64,611,397 bp
  • T to A, chromosome 8 at 117,673,647 bp
  • T to A, chromosome 8 at 121,829,420 bp
  • A to G, chromosome 8 at 124,876,934 bp
  • A to G, chromosome 9 at 72,942,926 bp
  • C to T, chromosome 9 at 77,754,927 bp
  • C to A, chromosome 9 at 105,783,903 bp
  • C to T, chromosome 10 at 60,777,438 bp
  • G to A, chromosome 10 at 61,300,155 bp
  • A to G, chromosome 10 at 130,472,149 bp
  • C to G, chromosome 11 at 3,524,708 bp
  • A to T, chromosome 11 at 67,298,652 bp
  • T to A, chromosome 12 at 56,345,688 bp
  • A to T, chromosome 13 at 56,789,760 bp
  • A to T, chromosome 13 at 112,856,789 bp
  • T to G, chromosome 13 at 112,859,652 bp
  • G to T, chromosome 14 at 7,917,274 bp
  • C to A, chromosome 14 at 40,911,133 bp
  • A to G, chromosome 14 at 50,642,358 bp
  • A to T, chromosome 14 at 70,477,922 bp
  • T to C, chromosome 15 at 12,373,374 bp
  • T to C, chromosome 15 at 75,948,422 bp
  • A to T, chromosome 15 at 76,107,503 bp
  • G to A, chromosome 15 at 99,722,086 bp
  • T to C, chromosome 16 at 36,867,607 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • T to C, chromosome 17 at 20,846,882 bp
  • A to G, chromosome 17 at 31,109,519 bp
  • A to G, chromosome 17 at 69,387,420 bp
  • A to T, chromosome 17 at 71,523,594 bp
  • A to G, chromosome 17 at 74,446,656 bp
  • A to G, chromosome 17 at 74,562,061 bp
  • G to A, chromosome 17 at 78,655,775 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • T to C, chromosome 19 at 37,220,423 bp
  • G to T, chromosome 19 at 38,716,851 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7716 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045774-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.