Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7716Btlr/Mmmh
Stock Number:
045774-MU
Citation ID:
RRID:MMRRC_045774-MU
Other Names:
R7716 (G1)
Major Collection:

Strain Information

Smco3
Name: single-pass membrane protein with coiled-coil domains 3
Synonyms: C030030A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 654818
Homologene: 79087
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Inpp5d
Name: inositol polyphosphate-5-phosphatase D
Synonyms: SHIP, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP-1, SHIP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16331
HGNC: HGNC:6079
Homologene: 4046
Cpe
Name: carboxypeptidase E
Synonyms: carboxypeptidase H, CPH, Cph1, Cph-1, NF-alpha1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12876
HGNC: HGNC:2303
Homologene: 48052
Strn
Name: striatin, calmodulin binding protein
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268980
Homologene: 2380
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Creb1
Name: cAMP responsive element binding protein 1
Synonyms: Creb-1, Creb, 2310001E10Rik, 3526402H21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12912
HGNC: HGNC:2345
Homologene: 3223
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 53,207,608 bp
  • C to T, chromosome 1 at 53,347,743 bp
  • T to C, chromosome 1 at 63,152,857 bp
  • T to A, chromosome 1 at 64,566,261 bp
  • A to G, chromosome 1 at 66,801,133 bp
  • G to A, chromosome 1 at 87,665,399 bp
  • C to T, chromosome 1 at 107,604,708 bp
  • A to C, chromosome 1 at 150,330,783 bp
  • T to A, chromosome 2 at 5,138,302 bp
  • A to G, chromosome 2 at 18,219,873 bp
  • A to G, chromosome 2 at 24,884,499 bp
  • T to A, chromosome 2 at 158,000,698 bp
  • C to A, chromosome 3 at 32,837,856 bp
  • G to A, chromosome 3 at 68,869,829 bp
  • A to C, chromosome 3 at 75,616,714 bp
  • T to C, chromosome 3 at 108,558,897 bp
  • G to T, chromosome 3 at 126,943,166 bp
  • T to A, chromosome 4 at 115,601,086 bp
  • T to A, chromosome 5 at 8,056,641 bp
  • C to T, chromosome 5 at 142,718,506 bp
  • T to A, chromosome 5 at 144,777,146 bp
  • C to T, chromosome 6 at 34,095,539 bp
  • T to C, chromosome 6 at 34,875,581 bp
  • T to C, chromosome 6 at 113,462,969 bp
  • AC to ACC, chromosome 6 at 113,690,898 bp
  • T to A, chromosome 6 at 124,061,745 bp
  • T to A, chromosome 6 at 136,831,249 bp
  • T to C, chromosome 7 at 5,359,820 bp
  • A to T, chromosome 7 at 86,386,054 bp
  • G to A, chromosome 7 at 98,599,766 bp
  • C to A, chromosome 7 at 126,462,187 bp
  • T to A, chromosome 7 at 127,392,087 bp
  • G to A, chromosome 7 at 133,643,726 bp
  • T to A, chromosome 8 at 54,584,986 bp
  • T to C, chromosome 8 at 64,611,397 bp
  • T to A, chromosome 8 at 117,673,647 bp
  • T to A, chromosome 8 at 121,829,420 bp
  • A to G, chromosome 8 at 124,876,934 bp
  • A to G, chromosome 9 at 72,942,926 bp
  • C to T, chromosome 9 at 77,754,927 bp
  • C to A, chromosome 9 at 105,783,903 bp
  • C to T, chromosome 10 at 60,777,438 bp
  • G to A, chromosome 10 at 61,300,155 bp
  • A to G, chromosome 10 at 130,472,149 bp
  • C to G, chromosome 11 at 3,524,708 bp
  • A to T, chromosome 11 at 67,298,652 bp
  • T to A, chromosome 12 at 56,345,688 bp
  • A to T, chromosome 13 at 56,789,760 bp
  • A to T, chromosome 13 at 112,856,789 bp
  • T to G, chromosome 13 at 112,859,652 bp
  • G to T, chromosome 14 at 7,917,274 bp
  • C to A, chromosome 14 at 40,911,133 bp
  • A to G, chromosome 14 at 50,642,358 bp
  • A to T, chromosome 14 at 70,477,922 bp
  • T to C, chromosome 15 at 12,373,374 bp
  • T to C, chromosome 15 at 75,948,422 bp
  • A to T, chromosome 15 at 76,107,503 bp
  • G to A, chromosome 15 at 99,722,086 bp
  • T to C, chromosome 16 at 36,867,607 bp
  • CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC to CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC, chromosome 16 at 91,656,691 bp
  • T to C, chromosome 17 at 20,846,882 bp
  • A to G, chromosome 17 at 31,109,519 bp
  • A to G, chromosome 17 at 69,387,420 bp
  • A to T, chromosome 17 at 71,523,594 bp
  • A to G, chromosome 17 at 74,446,656 bp
  • A to G, chromosome 17 at 74,562,061 bp
  • G to A, chromosome 17 at 78,655,775 bp
  • GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA, chromosome 18 at 57,293,999 bp
  • T to C, chromosome 19 at 37,220,423 bp
  • G to T, chromosome 19 at 38,716,851 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7716 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045774-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.