Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7718Btlr/Mmmh
Stock Number:
045775-MU
Citation ID:
RRID:MMRRC_045775-MU
Other Names:
R7718 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Ubp1
Name: upstream binding protein 1
Synonyms: NF2d9, LBP-1b, LBP-1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22221
VEGA: 9
Homologene: 8435
Psmd7
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Synonyms: Mov-34, Mov34
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17463
HGNC: HGNC:9565
Homologene: 2104
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 20,817,274 bp
  • T to G, chromosome 1 at 39,376,980 bp
  • A to T, chromosome 1 at 58,480,317 bp
  • T to C, chromosome 1 at 135,969,036 bp
  • G to A, chromosome 1 at 161,032,232 bp
  • T to C, chromosome 1 at 190,871,825 bp
  • T to C, chromosome 1 at 192,101,721 bp
  • T to C, chromosome 2 at 37,625,282 bp
  • A to G, chromosome 2 at 86,658,029 bp
  • A to T, chromosome 2 at 122,126,774 bp
  • G to T, chromosome 3 at 51,265,964 bp
  • C to T, chromosome 3 at 119,720,988 bp
  • A to G, chromosome 3 at 126,965,013 bp
  • T to C, chromosome 4 at 16,151,968 bp
  • T to C, chromosome 4 at 32,718,420 bp
  • T to A, chromosome 4 at 43,173,854 bp
  • C to T, chromosome 4 at 48,671,984 bp
  • T to A, chromosome 4 at 123,824,919 bp
  • C to T, chromosome 4 at 148,602,747 bp
  • A to G, chromosome 4 at 154,974,643 bp
  • A to T, chromosome 5 at 8,715,788 bp
  • A to G, chromosome 5 at 34,694,816 bp
  • C to T, chromosome 5 at 51,498,162 bp
  • A to G, chromosome 5 at 76,317,999 bp
  • T to C, chromosome 5 at 100,062,160 bp
  • A to G, chromosome 5 at 123,445,514 bp
  • A to T, chromosome 5 at 127,563,440 bp
  • A to T, chromosome 5 at 138,647,860 bp
  • A to C, chromosome 6 at 17,854,999 bp
  • A to T, chromosome 6 at 47,554,191 bp
  • G to A, chromosome 6 at 50,589,098 bp
  • A to T, chromosome 6 at 70,766,618 bp
  • A to G, chromosome 6 at 90,598,323 bp
  • AGG to AG, chromosome 6 at 130,013,352 bp
  • G to A, chromosome 7 at 18,792,443 bp
  • T to C, chromosome 7 at 28,147,201 bp
  • A to G, chromosome 7 at 30,554,347 bp
  • C to T, chromosome 7 at 44,661,040 bp
  • T to C, chromosome 7 at 45,977,392 bp
  • T to G, chromosome 7 at 46,938,056 bp
  • T to G, chromosome 7 at 49,770,884 bp
  • A to T, chromosome 7 at 107,128,718 bp
  • T to C, chromosome 7 at 108,103,648 bp
  • T to C, chromosome 7 at 132,558,259 bp
  • C to T, chromosome 8 at 69,817,733 bp
  • T to A, chromosome 8 at 95,095,208 bp
  • A to T, chromosome 8 at 107,586,629 bp
  • A to G, chromosome 8 at 109,733,234 bp
  • A to G, chromosome 9 at 9,984,128 bp
  • A to T, chromosome 9 at 18,409,231 bp
  • A to G, chromosome 9 at 86,679,900 bp
  • A to G, chromosome 9 at 113,973,529 bp
  • A to G, chromosome 10 at 76,070,573 bp
  • A to G, chromosome 10 at 127,079,865 bp
  • T to C, chromosome 11 at 34,402,539 bp
  • A to T, chromosome 11 at 65,218,626 bp
  • A to G, chromosome 11 at 107,081,456 bp
  • A to T, chromosome 12 at 82,342,497 bp
  • A to G, chromosome 12 at 85,029,122 bp
  • A to T, chromosome 14 at 51,195,760 bp
  • A to G, chromosome 15 at 5,099,787 bp
  • A to C, chromosome 15 at 76,177,439 bp
  • T to C, chromosome 16 at 18,250,623 bp
  • T to C, chromosome 16 at 35,280,415 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • T to A, chromosome 17 at 12,922,162 bp
  • A to G, chromosome 17 at 24,586,500 bp
  • T to A, chromosome 17 at 25,947,024 bp
  • C to A, chromosome 17 at 28,333,517 bp
  • T to C, chromosome 17 at 35,622,836 bp
  • C to A, chromosome 17 at 45,643,781 bp
  • A to G, chromosome 17 at 56,696,718 bp
  • A to T, chromosome 18 at 20,041,778 bp
  • A to G, chromosome 18 at 37,475,163 bp
  • A to G, chromosome 18 at 37,505,651 bp
  • C to G, chromosome 19 at 4,934,556 bp
  • T to A, chromosome 19 at 39,767,338 bp
  • T to A, chromosome 19 at 57,740,183 bp
  • T to C, chromosome 19 at 58,453,457 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7718 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045775-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.