Strain Name:
C57BL/6J-MtgxR7718Btlr/Mmmh
Stock Number:
045775-MU
Citation ID:
RRID:MMRRC_045775-MU
Other Names:
R7718 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC-1, PC1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Pank4
Name: pantothenate kinase 4
Synonyms: D030031I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269614
Homologene: 41235
Ank2
Name: ankyrin 2, brain
Synonyms: Ankyrin-2, Ankyrin-B, ankyrin B, Gm4392, Ank-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: Fthfd, 1810048F20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Ubp1
Name: upstream binding protein 1
Synonyms: NF2d9, LBP-1b, LBP-1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22221
VEGA: 9
Homologene: 8435
Psmd7
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 7
Synonyms: Mov34, Mov-34
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17463
HGNC: HGNC:9565
Homologene: 2104
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: Spar, 4931426N11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Tead3
Name: TEA domain family member 3
Synonyms: TEF-5, Tcf13r2, ETFR-1, TEAD-3, DTEF-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21678
Homologene: 81821
Ylpm1
Name: YLP motif containing 1
Synonyms: Zap3, ZAP, A930013E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56531
Homologene: 87707
Ezh2
Name: enhancer of zeste 2 polycomb repressive complex 2 subunit
Synonyms: KMT6, Enx1h, Enx-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14056
HGNC: HGNC:3527
Homologene: 37926
Mcm3
Name: minichromosome maintenance complex component 3
Synonyms: p1.m, Mcmd, P1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17215
HGNC: HGNC:6945
Homologene: 1791
Rps6kc1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: RPK118, B130003F20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320119
Homologene: 8244
Katnb1
Name: katanin p80 (WD40-containing) subunit B 1
Synonyms: 2410003J24Rik, KAT
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74187
HGNC: HGNC:6217
Homologene: 4302
Ptbp2
Name: polypyrimidine tract binding protein 2
Synonyms: brPTB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56195
Homologene: 23162
Orc2
Name: origin recognition complex, subunit 2
Synonyms: Orc2l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18393
HGNC: HGNC:8488
Homologene: 4512
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Ranbp3
Name: RAN binding protein 3
Synonyms: 2610024N24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71810
VEGA: 17
HGNC: HGNC:9850
Homologene: 136516
Tbc1d8
Name: TBC1 domain family, member 8
Synonyms: HBLP1, BUB2-like protein 1, AD3, GRAM domain
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54610
Homologene: 31421
Mdn1
Name: midasin AAA ATPase 1
Synonyms: 4833432B22Rik, D4Abb1e, LOC213784
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
St7
Name: suppression of tumorigenicity 7
Synonyms: HELG, SEN4, RAY1, TSG7, 9430001H04Rik, Fam4a2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64213
Homologene: 10185
Myh14
Name: myosin, heavy polypeptide 14
Synonyms: 2400004E04Rik, NMHC II-C
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71960
Homologene: 23480
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Tcp1
Name: t-complex protein 1
Synonyms: p63, Tcp-1, c-cpn, Cct1, TRic, CCT, Tp63, Ccta
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21454
Homologene: 5656
Enoph1
Name: enolase-phosphatase 1
Synonyms: 2310057D15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67870
Homologene: 5790
Elf2
Name: E74-like factor 2
Synonyms: NERF-2, 2610036A20Rik, A230104O07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69257
HGNC: HGNC:3317
Homologene: 5006
Strbp
Name: spermatid perinuclear RNA binding protein
Synonyms: Spnr, 6430510M02Rik, C230082I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20744
Homologene: 7548
Trmt2a
Name: TRM2 tRNA methyltransferase 2A
Synonyms: Htf9c
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15547
Homologene: 7374
Capn11
Name: calpain 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268958
HGNC: HGNC:1478
Homologene: 21392
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Oat
Name: ornithine aminotransferase
Synonyms: rhg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18242
HGNC: HGNC:8091
Homologene: 231
Patl2
Name: protein associated with topoisomerase II homolog 2 (yeast)
Synonyms: Pat1a, 4930424G05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67578
Homologene: 12155
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Rhbdl2
Name: rhomboid like 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230726
Homologene: 49508
Prr35
Name: proline rich 35
Synonyms: A930017K11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100034748
Adcy5
Name: adenylate cyclase 5
Synonyms: AC5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224129
VEGA: 16
HGNC: HGNC:236
Homologene: 11213
Abcc6
Name: ATP-binding cassette, sub-family C member 6
Synonyms: DCC, Dyscalc1, Mrp6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
Ripk2
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: CCK, D4Bwg0615e, CARD3, RICK, RIP2, CARDIAK, 2210420D18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192656
Homologene: 37856
Myocd
Name: myocardin
Synonyms: Srfcp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 214384
Homologene: 17043
Htatip2
Name: HIV-1 Tat interactive protein 2
Synonyms: TIP30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53415
Homologene: 4676
Agap2
Name: ArfGAP with GTPase domain, ankyrin repeat and PH domain 2
Synonyms: Centg1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216439
VEGA: 10
Homologene: 86815
Tmem132c
Name: transmembrane protein 132C
Synonyms: 4632425D07Rik, 2810482M11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208213
Homologene: 76567
Atrnl1
Name: attractin like 1
Synonyms: Alp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226255
VEGA: 19
Homologene: 45809
Grk4
Name: G protein-coupled receptor kinase 4
Synonyms: Gprk2l, A830025H08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14772
HGNC: HGNC:4543
Homologene: 23158
Gmip
Name: Gem-interacting protein
Synonyms: 5031419I10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78816
Homologene: 9570
Ubtfl1
Name: upstream binding transcription factor, RNA polymerase I-like 1
Synonyms: Hmgpi, B020006M18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546118
Homologene: 110115
Me1
Name: malic enzyme 1, NADP(+)-dependent, cytosolic
Synonyms: Mdh-1, D9Ertd267e, Mod1, Mod-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17436
HGNC: HGNC:6983
Homologene: 134785
Or8k38
Name: olfactory receptor family 8 subfamily K member 38
Synonyms: MOR191-1, GA_x6K02T2Q125-48147264-48146323, Olfr1085
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258583
Mlxip
Name: MLX interacting protein
Synonyms: bHLHe36, Mondoa, Mir
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208104
Homologene: 22851
Psg19
Name: pregnancy specific beta-1-glycoprotein 19
Synonyms: Cea-4, Cea4, CGM7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26439
HGNC: HGNC:1819
Homologene: 110989
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
A430033K04Rik
Name: RIKEN cDNA A430033K04 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243308
Homologene: 65621
Uevld
Name: UEV and lactate/malate dehyrogenase domains
Synonyms: Attp, 8430408E05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54122
Homologene: 69251
Zbtb37
Name: zinc finger and BTB domain containing 37
Synonyms: D430004I08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240869
Homologene: 13048
Cntn5
Name: contactin 5
Synonyms: 6720426O10Rik, LOC244683, A830025P08Rik, NB-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244682
HGNC: HGNC:2175
Homologene: 28447
Gfra1
Name: glial cell line derived neurotrophic factor family receptor alpha 1
Synonyms: GDNFR-alpha, GFR alpha-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14585
HGNC: HGNC:4243
Homologene: 3855
Slc5a4b
Name: solute carrier family 5 (neutral amino acid transporters, system A), member 4b
Synonyms: 2010104G07Rik, pSGLT2, SAAT1, SGLT3b
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64454
Homologene: 56968
Pcdhb15
Name: protocadherin beta 15
Synonyms: Pcdhb7, PcdhbO
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93886
HGNC: HGNC:8692
Homologene: 32429
Cyp2c40
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13099
Homologene: 74936
Ang2
Name: angiogenin, ribonuclease A family, member 2
Synonyms: Angrp, Rnase5b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11731
VEGA: 14
HGNC: HGNC:483
Pdcl2
Name: phosducin-like 2
Synonyms: 1700016K07Rik, 1700010B22Rik, Mgcphlp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 79455
Homologene: 74832
Dsc2
Name: desmocollin 2
Synonyms: Dsc2a, Dsc2b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Insyn2b
Name: inhibitory synaptic factor family member 2B
Synonyms: Fam196b, Gm6041
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 574403
VEGA: 11
Homologene: 107175
Muc21
Name: mucin 21
Synonyms: Gm9573, epiglycanin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Masp2
Name: MBL associated serine protease 2
Synonyms: MAp19, MASP-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17175
HGNC: HGNC:6902
Homologene: 4819
Abcb1a
Name: ATP-binding cassette, sub-family B member 1A
Synonyms: mdr-3, Pgy3, Evi32, Pgp, MDR3, Mdr1a, P-glycoprotein, multiple drug resistant 1a, Pgy-3, P-gp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18671
HGNC: HGNC:40
Homologene: 55496
Atxn1l
Name: ataxin 1-like
Synonyms: ENSMUSG00000069895, Boat, C330011L24Rik, D8Ertd587e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52335
Homologene: 19471
Or2d2
Name: olfactory receptor family 2 subfamily D member 2
Synonyms: Olfr715, MOR260-1, GA_x6K02T2PBJ9-9479517-9478573
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258776
HGNC: HGNC:8244
Homologene: 81541
Klra6
Name: killer cell lectin-like receptor, subfamily A, member 6
Synonyms: Ly49f, Ly49F
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16637
Homologene: 110821
Rcor3
Name: REST corepressor 3
Synonyms: C730034D20Rik, E130101E15Rik, 4921514E24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214742
Homologene: 135671
Peli3
Name: pellino 3
Synonyms: 6030441F14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240518
Homologene: 27059
Spmip4
Name: sperm microtubule inner protein 4
Synonyms: 4921507P07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70821
Homologene: 69433
Or5p59
Name: olfactory receptor family 5 subfamily P member 59
Synonyms: Olfr483, GA_x6K02T2PBJ9-10432095-10433042, MOR204-12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258730
Homologene: 133602
Pcdhb20
Name: protocadherin beta 20
Synonyms: Pcdhb14, PcdhbT
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93891
HGNC: HGNC:8685
Homologene: 134303
Cavin4
Name: caveolae associated 4
Synonyms: cavin 4, Murc, 2310039E09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68016
Homologene: 12224
Rpia
Name: ribose 5-phosphate isomerase A
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19895
Homologene: 6943
Ppargc1a
Name: peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
Synonyms: Pgc-1alpha, Pgco1, PPAR Gamma Coactivator-1, Gm11133, Pgc1, Pgc-1alphaa, A830037N07Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19017
HGNC: HGNC:9237
Homologene: 7485
Hspb6
Name: heat shock protein, alpha-crystallin-related, B6
Synonyms: Hsp20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243912
Homologene: 36931
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 20,817,274 bp
  • T to G, chromosome 1 at 39,376,980 bp
  • A to T, chromosome 1 at 58,480,317 bp
  • T to C, chromosome 1 at 135,969,036 bp
  • G to A, chromosome 1 at 161,032,232 bp
  • T to C, chromosome 1 at 190,871,825 bp
  • T to C, chromosome 1 at 192,101,721 bp
  • T to C, chromosome 2 at 37,625,282 bp
  • A to G, chromosome 2 at 86,658,029 bp
  • A to T, chromosome 2 at 122,126,774 bp
  • G to T, chromosome 3 at 51,265,964 bp
  • C to T, chromosome 3 at 119,720,988 bp
  • A to G, chromosome 3 at 126,965,013 bp
  • T to C, chromosome 4 at 16,151,968 bp
  • T to C, chromosome 4 at 32,718,420 bp
  • T to A, chromosome 4 at 43,173,854 bp
  • C to T, chromosome 4 at 48,671,984 bp
  • T to A, chromosome 4 at 123,824,919 bp
  • C to T, chromosome 4 at 148,602,747 bp
  • A to G, chromosome 4 at 154,974,643 bp
  • A to T, chromosome 5 at 8,715,788 bp
  • A to G, chromosome 5 at 34,694,816 bp
  • C to T, chromosome 5 at 51,498,162 bp
  • A to G, chromosome 5 at 76,317,999 bp
  • T to C, chromosome 5 at 100,062,160 bp
  • A to G, chromosome 5 at 123,445,514 bp
  • A to T, chromosome 5 at 127,563,440 bp
  • A to T, chromosome 5 at 138,647,860 bp
  • A to C, chromosome 6 at 17,854,999 bp
  • A to T, chromosome 6 at 47,554,191 bp
  • G to A, chromosome 6 at 50,589,098 bp
  • A to T, chromosome 6 at 70,766,618 bp
  • A to G, chromosome 6 at 90,598,323 bp
  • AGG to AG, chromosome 6 at 130,013,352 bp
  • G to A, chromosome 7 at 18,792,443 bp
  • T to C, chromosome 7 at 28,147,201 bp
  • A to G, chromosome 7 at 30,554,347 bp
  • C to T, chromosome 7 at 44,661,040 bp
  • T to C, chromosome 7 at 45,977,392 bp
  • T to G, chromosome 7 at 46,938,056 bp
  • T to G, chromosome 7 at 49,770,884 bp
  • A to T, chromosome 7 at 107,128,718 bp
  • T to C, chromosome 7 at 108,103,648 bp
  • T to C, chromosome 7 at 132,558,259 bp
  • C to T, chromosome 8 at 69,817,733 bp
  • T to A, chromosome 8 at 95,095,208 bp
  • A to T, chromosome 8 at 107,586,629 bp
  • A to G, chromosome 8 at 109,733,234 bp
  • A to G, chromosome 9 at 9,984,128 bp
  • A to T, chromosome 9 at 18,409,231 bp
  • A to G, chromosome 9 at 86,679,900 bp
  • A to G, chromosome 9 at 113,973,529 bp
  • A to G, chromosome 10 at 76,070,573 bp
  • A to G, chromosome 10 at 127,079,865 bp
  • T to C, chromosome 11 at 34,402,539 bp
  • A to T, chromosome 11 at 65,218,626 bp
  • A to G, chromosome 11 at 107,081,456 bp
  • A to T, chromosome 12 at 82,342,497 bp
  • A to G, chromosome 12 at 85,029,122 bp
  • A to T, chromosome 14 at 51,195,760 bp
  • A to G, chromosome 15 at 5,099,787 bp
  • A to C, chromosome 15 at 76,177,439 bp
  • T to C, chromosome 16 at 18,250,623 bp
  • T to C, chromosome 16 at 35,280,415 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • T to A, chromosome 17 at 12,922,162 bp
  • A to G, chromosome 17 at 24,586,500 bp
  • T to A, chromosome 17 at 25,947,024 bp
  • C to A, chromosome 17 at 28,333,517 bp
  • T to C, chromosome 17 at 35,622,836 bp
  • C to A, chromosome 17 at 45,643,781 bp
  • A to G, chromosome 17 at 56,696,718 bp
  • A to T, chromosome 18 at 20,041,778 bp
  • A to G, chromosome 18 at 37,475,163 bp
  • A to G, chromosome 18 at 37,505,651 bp
  • C to G, chromosome 19 at 4,934,556 bp
  • T to A, chromosome 19 at 39,767,338 bp
  • T to A, chromosome 19 at 57,740,183 bp
  • T to C, chromosome 19 at 58,453,457 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7718 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045775-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.