Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7731Btlr/Mmmh
Stock Number:
045787-MU
Citation ID:
RRID:MMRRC_045787-MU
Other Names:
R7731 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Sptlc1
Name: serine palmitoyltransferase, long chain base subunit 1
Synonyms: Lcb1, Spt1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268656
VEGA: 13
Homologene: 4681
Uchl5
Name: ubiquitin carboxyl-terminal esterase L5
Synonyms: Uch37, 5830413B11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56207
Homologene: 9326
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 46,139,745 bp
  • A to T, chromosome 1 at 69,539,143 bp
  • T to C, chromosome 1 at 143,794,537 bp
  • T to G, chromosome 2 at 5,924,112 bp
  • G to A, chromosome 2 at 22,282,589 bp
  • A to G, chromosome 2 at 37,201,549 bp
  • T to C, chromosome 2 at 87,049,234 bp
  • T to C, chromosome 2 at 93,861,018 bp
  • A to G, chromosome 2 at 127,229,102 bp
  • A to G, chromosome 2 at 167,689,206 bp
  • T to A, chromosome 3 at 76,661,762 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • T to C, chromosome 3 at 95,483,775 bp
  • T to C, chromosome 3 at 144,952,785 bp
  • T to A, chromosome 4 at 117,108,295 bp
  • C to A, chromosome 4 at 123,444,879 bp
  • C to A, chromosome 4 at 130,762,963 bp
  • C to T, chromosome 5 at 65,075,562 bp
  • A to C, chromosome 5 at 121,307,014 bp
  • A to G, chromosome 5 at 137,758,694 bp
  • C to A, chromosome 5 at 145,151,364 bp
  • A to G, chromosome 6 at 49,134,731 bp
  • T to C, chromosome 6 at 55,345,819 bp
  • T to C, chromosome 6 at 57,926,334 bp
  • G to T, chromosome 6 at 91,071,888 bp
  • C to A, chromosome 6 at 95,118,578 bp
  • T to C, chromosome 6 at 112,766,897 bp
  • A to G, chromosome 6 at 126,865,068 bp
  • A to G, chromosome 6 at 136,328,873 bp
  • T to A, chromosome 7 at 17,158,350 bp
  • C to T, chromosome 7 at 64,372,696 bp
  • A to T, chromosome 7 at 66,033,893 bp
  • T to C, chromosome 7 at 89,408,050 bp
  • A to G, chromosome 7 at 102,774,934 bp
  • T to C, chromosome 7 at 127,198,821 bp
  • A to T, chromosome 7 at 141,857,305 bp
  • G to A, chromosome 8 at 3,384,936 bp
  • A to G, chromosome 8 at 105,298,633 bp
  • C to A, chromosome 8 at 117,131,068 bp
  • G to A, chromosome 8 at 122,895,433 bp
  • T to C, chromosome 9 at 24,770,697 bp
  • A to G, chromosome 9 at 38,756,246 bp
  • A to G, chromosome 9 at 99,620,417 bp
  • T to C, chromosome 9 at 108,044,728 bp
  • C to T, chromosome 9 at 119,170,611 bp
  • C to T, chromosome 10 at 14,149,714 bp
  • A to G, chromosome 10 at 57,802,554 bp
  • T to G, chromosome 10 at 77,826,820 bp
  • T to A, chromosome 10 at 82,377,527 bp
  • A to C, chromosome 10 at 116,237,295 bp
  • A to T, chromosome 11 at 53,266,964 bp
  • A to T, chromosome 11 at 55,310,706 bp
  • T to C, chromosome 11 at 69,000,045 bp
  • T to A, chromosome 11 at 72,712,281 bp
  • T to C, chromosome 11 at 75,508,906 bp
  • T to C, chromosome 11 at 97,841,400 bp
  • T to C, chromosome 11 at 118,169,053 bp
  • A to T, chromosome 12 at 31,933,368 bp
  • G to A, chromosome 12 at 37,414,940 bp
  • G to C, chromosome 12 at 111,430,748 bp
  • A to G, chromosome 13 at 53,333,957 bp
  • T to C, chromosome 13 at 67,139,626 bp
  • A to T, chromosome 14 at 34,223,067 bp
  • T to A, chromosome 14 at 50,533,684 bp
  • T to G, chromosome 14 at 55,710,521 bp
  • T to C, chromosome 15 at 39,033,932 bp
  • A to G, chromosome 15 at 59,315,972 bp
  • A to T, chromosome 15 at 73,562,367 bp
  • A to G, chromosome 15 at 82,455,432 bp
  • C to T, chromosome 16 at 13,677,759 bp
  • G to A, chromosome 16 at 27,346,918 bp
  • A to G, chromosome 16 at 32,670,134 bp
  • G to A, chromosome 17 at 7,773,439 bp
  • A to T, chromosome 17 at 24,573,898 bp
  • A to G, chromosome 17 at 32,211,224 bp
  • T to A, chromosome 17 at 43,450,560 bp
  • A to T, chromosome 18 at 37,756,511 bp
  • A to T, chromosome 18 at 82,680,673 bp
  • T to A, chromosome 19 at 8,959,262 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7731 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045787-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.