Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7737Btlr/Mmmh
Stock Number:
045793-MU
Citation ID:
RRID:MMRRC_045793-MU
Other Names:
R7737 (G1)
Major Collection:

Strain Information

Itga6
Name: integrin alpha 6
Synonyms: Cd49f, 5033401O05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16403
HGNC: HGNC:6142
Homologene: 20091
Epha4
Name: Eph receptor A4
Synonyms: Sek, Sek1, Tyro1, Hek8, Cek8, 2900005C20Rik, rb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13838
HGNC: HGNC:3388
Homologene: 20933
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Mtor
Name: mechanistic target of rapamycin kinase
Synonyms: FKBP-rapamycin-associated protein FRAP, 2610315D21Rik, RAPT1, RAFT1, flat, Frap1, mechanistic target of rapamycin (serine/threonine kinase)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56717
HGNC: HGNC:3942
Homologene: 3637
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Larp4b
Name: La ribonucleoprotein 4B
Synonyms: D13Wsu64e, Larp5, A130023E24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217980
Homologene: 18195
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 75,211,351 bp
  • C to T, chromosome 1 at 77,381,012 bp
  • A to G, chromosome 1 at 127,491,610 bp
  • A to T, chromosome 1 at 128,298,693 bp
  • G to T, chromosome 1 at 146,682,594 bp
  • A to G, chromosome 1 at 155,241,673 bp
  • A to T, chromosome 2 at 36,640,620 bp
  • T to A, chromosome 2 at 39,123,022 bp
  • T to C, chromosome 2 at 69,496,438 bp
  • A to G, chromosome 2 at 69,991,566 bp
  • G to A, chromosome 2 at 71,822,443 bp
  • T to C, chromosome 2 at 109,137,378 bp
  • T to A, chromosome 2 at 131,303,496 bp
  • T to A, chromosome 2 at 134,639,668 bp
  • C to T, chromosome 4 at 118,478,857 bp
  • C to G, chromosome 4 at 133,575,096 bp
  • A to C, chromosome 4 at 143,991,956 bp
  • A to C, chromosome 4 at 148,538,738 bp
  • AACT to A, chromosome 5 at 25,950,851 bp
  • T to C, chromosome 5 at 35,723,953 bp
  • A to C, chromosome 5 at 108,617,008 bp
  • T to C, chromosome 5 at 135,135,381 bp
  • A to T, chromosome 6 at 39,144,404 bp
  • A to G, chromosome 6 at 43,273,794 bp
  • T to A, chromosome 6 at 126,874,102 bp
  • A to T, chromosome 7 at 11,669,707 bp
  • T to A, chromosome 7 at 28,157,073 bp
  • A to T, chromosome 7 at 81,025,193 bp
  • T to C, chromosome 7 at 92,605,262 bp
  • C to T, chromosome 7 at 104,279,564 bp
  • A to T, chromosome 7 at 116,356,253 bp
  • A to G, chromosome 7 at 134,270,201 bp
  • A to G, chromosome 8 at 78,505,623 bp
  • A to T, chromosome 8 at 85,112,215 bp
  • A to T, chromosome 8 at 94,022,833 bp
  • A to T, chromosome 8 at 113,736,934 bp
  • T to A, chromosome 8 at 119,742,395 bp
  • T to A, chromosome 9 at 101,984,103 bp
  • G to T, chromosome 9 at 109,701,263 bp
  • G to T, chromosome 9 at 111,366,012 bp
  • A to G, chromosome 10 at 40,003,278 bp
  • A to G, chromosome 11 at 79,545,488 bp
  • A to T, chromosome 11 at 115,887,923 bp
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp
  • A to G, chromosome 11 at 118,303,895 bp
  • T to C, chromosome 12 at 75,942,848 bp
  • G to A, chromosome 12 at 87,221,362 bp
  • T to A, chromosome 13 at 9,170,643 bp
  • G to A, chromosome 13 at 9,695,139 bp
  • C to A, chromosome 13 at 24,975,726 bp
  • A to G, chromosome 13 at 66,433,677 bp
  • A to G, chromosome 13 at 73,788,677 bp
  • A to T, chromosome 14 at 19,599,737 bp
  • G to T, chromosome 15 at 36,210,710 bp
  • A to T, chromosome 15 at 91,815,446 bp
  • G to A, chromosome 16 at 18,397,101 bp
  • T to C, chromosome 16 at 30,581,185 bp
  • G to A, chromosome 17 at 8,245,094 bp
  • G to A, chromosome 17 at 46,236,090 bp
  • A to G, chromosome 18 at 7,217,890 bp
  • G to T, chromosome 18 at 21,558,134 bp
  • A to T, chromosome 18 at 32,014,204 bp
  • G to A, chromosome 19 at 3,274,467 bp
  • A to T, chromosome 19 at 7,896,762 bp
  • C to T, chromosome 19 at 10,625,974 bp
  • G to A, chromosome 19 at 11,302,786 bp
  • T to C, chromosome X at 170,676,440 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7737 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045793-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.