Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7740Btlr/Mmmh
Stock Number:
045796-MU
Citation ID:
RRID:MMRRC_045796-MU
Other Names:
R7740 (G1)
Major Collection:

Strain Information

Tomm20
Name: translocase of outer mitochondrial membrane 20
Synonyms: TOM20, 1810060K07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67952
Homologene: 44649
Cpe
Name: carboxypeptidase E
Synonyms: carboxypeptidase H, CPH, Cph1, Cph-1, NF-alpha1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12876
HGNC: HGNC:2303
Homologene: 48052
Il21r
Name: interleukin 21 receptor
Synonyms: NILR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60504
HGNC: HGNC:6006
Homologene: 11040
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ddx23
Name: DEAD box helicase 23
Synonyms: 4921506D17Rik, 3110082M05Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74351
Homologene: 3542
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 14,912,401 bp
  • T to C, chromosome 1 at 105,731,261 bp
  • T to A, chromosome 1 at 139,237,690 bp
  • T to C, chromosome 1 at 151,440,888 bp
  • T to C, chromosome 1 at 160,682,103 bp
  • A to G, chromosome 1 at 171,216,827 bp
  • A to G, chromosome 2 at 13,010,672 bp
  • G to A, chromosome 2 at 15,614,215 bp
  • C to T, chromosome 2 at 29,930,624 bp
  • T to C, chromosome 2 at 34,700,822 bp
  • A to T, chromosome 2 at 111,780,448 bp
  • T to A, chromosome 2 at 153,208,743 bp
  • T to A, chromosome 2 at 153,903,009 bp
  • T to A, chromosome 2 at 156,997,716 bp
  • G to T, chromosome 4 at 12,145,954 bp
  • T to A, chromosome 4 at 35,709,248 bp
  • G to T, chromosome 4 at 59,612,724 bp
  • G to T, chromosome 4 at 63,834,446 bp
  • A to T, chromosome 4 at 115,493,609 bp
  • A to G, chromosome 4 at 123,684,303 bp
  • A to G, chromosome 5 at 24,431,668 bp
  • A to T, chromosome 5 at 109,091,749 bp
  • A to T, chromosome 5 at 109,220,458 bp
  • G to A, chromosome 5 at 109,737,504 bp
  • T to A, chromosome 5 at 110,331,041 bp
  • C to T, chromosome 6 at 54,300,171 bp
  • T to G, chromosome 6 at 57,659,817 bp
  • C to T, chromosome 6 at 68,270,990 bp
  • T to A, chromosome 6 at 119,761,188 bp
  • G to A, chromosome 7 at 30,663,253 bp
  • T to A, chromosome 7 at 125,632,555 bp
  • C to T, chromosome 7 at 142,174,962 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • T to A, chromosome 8 at 27,462,024 bp
  • T to C, chromosome 8 at 64,597,528 bp
  • T to A, chromosome 8 at 104,966,330 bp
  • A to G, chromosome 8 at 126,939,883 bp
  • A to G, chromosome 10 at 11,390,940 bp
  • G to T, chromosome 10 at 14,127,670 bp
  • T to A, chromosome 10 at 28,496,924 bp
  • A to G, chromosome 10 at 63,269,678 bp
  • A to T, chromosome 10 at 81,499,021 bp
  • T to A, chromosome 10 at 127,300,575 bp
  • T to C, chromosome 11 at 50,900,778 bp
  • T to A, chromosome 11 at 55,007,899 bp
  • T to A, chromosome 11 at 72,359,718 bp
  • T to C, chromosome 11 at 98,993,814 bp
  • T to C, chromosome 11 at 100,591,561 bp
  • C to A, chromosome 12 at 16,740,121 bp
  • T to C, chromosome 12 at 65,126,547 bp
  • T to C, chromosome 12 at 104,954,287 bp
  • T to G, chromosome 14 at 37,089,380 bp
  • T to C, chromosome 14 at 50,140,346 bp
  • C to T, chromosome 14 at 72,440,673 bp
  • A to G, chromosome 15 at 12,374,016 bp
  • C to T, chromosome 15 at 91,767,324 bp
  • A to T, chromosome 15 at 98,658,434 bp
  • A to T, chromosome 16 at 20,527,250 bp
  • T to C, chromosome 16 at 23,321,035 bp
  • A to G, chromosome 16 at 45,104,525 bp
  • A to G, chromosome 16 at 94,114,960 bp
  • T to C, chromosome 16 at 96,027,368 bp
  • T to C, chromosome 17 at 21,560,990 bp
  • T to C, chromosome 18 at 37,727,417 bp
  • T to C, chromosome 18 at 61,000,423 bp
  • C to A, chromosome 19 at 6,537,169 bp
  • T to C, chromosome 19 at 13,749,964 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7740 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045796-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.