Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7740Btlr/Mmmh
Stock Number:
045796-MU
Citation ID:
RRID:MMRRC_045796-MU
Other Names:
R7740 (G1)
Major Collection:

Strain Information

Tomm20
Name: translocase of outer mitochondrial membrane 20
Synonyms: TOM20, 1810060K07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67952
Homologene: 44649
Cpe
Name: carboxypeptidase E
Synonyms: carboxypeptidase H, CPH, Cph1, Cph-1, NF-alpha1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12876
HGNC: HGNC:2303
Homologene: 48052
Il21r
Name: interleukin 21 receptor
Synonyms: NILR
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60504
HGNC: HGNC:6006
Homologene: 11040
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ddx23
Name: DEAD box helicase 23
Synonyms: 4921506D17Rik, 3110082M05Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 23
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74351
Homologene: 3542
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Herc4
Name: hect domain and RLD 4
Synonyms: 4921531D01Rik, 1700056O17Rik, 9530080M15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67345
VEGA: 10
Homologene: 56715
Tm9sf4
Name: transmembrane 9 superfamily member 4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99237
Homologene: 21620
Slc4a2
Name: solute carrier family 4 (anion exchanger), member 2
Synonyms: B3RP, Ae2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20535
Homologene: 128699
Dnajc7
Name: DnaJ heat shock protein family (Hsp40) member C7
Synonyms: mDj11, Ttc2, mTpr2, 2010003F24Rik, 2010004G07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56354
Homologene: 68306
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227446
Homologene: 10834
Brwd1
Name: bromodomain and WD repeat domain containing 1
Synonyms: 5330419I02Rik, D530019K20Rik, G1-403-16, Wdr9, repro5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 93871
Homologene: 23130
Top2a
Name: topoisomerase (DNA) II alpha
Synonyms: DNA Topoisomerase II alpha, Top-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21973
Homologene: 830
Gapvd1
Name: GTPase activating protein and VPS9 domains 1
Synonyms: 2010005B09Rik, 4432404J10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66691
Homologene: 32637
Mars1
Name: methionine-tRNA synthetase 1
Synonyms: MetRS, methionine tRNA ligase, methionyl-tRNA synthetase, Mars
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216443
HGNC: HGNC:6898
Homologene: 90878
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Urb, Ssg1, 2610001E17Rik, DRO1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67896
Homologene: 12206
Cdhr1
Name: cadherin-related family member 1
Synonyms: Prcad, Pcdh21
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 170677
VEGA: 14
Homologene: 13215
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: RAB6IP2B, RAB6IP2A, 5033405M01Rik, B430107L16Rik, 9630025C19Rik, Rab6ip2, Elks1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Chn2
Name: chimerin 2
Synonyms: 1700026N20Rik, 4930557O16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69993
HGNC: HGNC:1944
Homologene: 31213
4930522L14Rik
Name: RIKEN cDNA 4930522L14 gene
Synonyms: Gm42152
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100041734
Anxa6
Name: annexin A6
Synonyms: Camb, Anx6, AnxVI, Annexin VI, Cabm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11749
HGNC: HGNC:544
Homologene: 55558
Fancm
Name: Fanconi anemia, complementation group M
Synonyms: C730036B14Rik, D12Ertd364e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104806
VEGA: 12
Homologene: 35378
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
C1ql3
Name: C1q-like 3
Synonyms: K100, 1110065A22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227580
Homologene: 17701
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: A930008G09Rik, 7530426H14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Sim2
Name: single-minded family bHLH transcription factor 2
Synonyms: bHLHe15
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20465
VEGA: 16
Homologene: 3716
Tnfsf8
Name: tumor necrosis factor (ligand) superfamily, member 8
Synonyms: Cd30L, CD153, CD30LG
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21949
Homologene: 950
Hivep2
Name: human immunodeficiency virus type I enhancer binding protein 2
Synonyms: MIBP1, Schnurri-2, Shn-2, Gm20114
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15273
HGNC: HGNC:4921
Homologene: 4900
Nr1i3
Name: nuclear receptor subfamily 1, group I, member 3
Synonyms: CAR1, MB67, Care2, ESTM32, mCAR, CAR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12355
HGNC: HGNC:7969
Homologene: 3759
Ces2g
Name: carboxylesterase 2G
Synonyms: 2210023G05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72361
HGNC: HGNC:1864
Homologene: 77154
Ankrd69
Name: ankyrin repeat domain 69
Synonyms: 4930456F22Rik, 4921537P18Rik, Poteg
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70952
Homologene: 134158
Haus5
Name: HAUS augmin-like complex, subunit 5
Synonyms: 2310022K01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71909
Homologene: 18969
Rabgap1l
Name: RAB GTPase activating protein 1-like
Synonyms: Hh1, 9630005B12Rik, 5830411O09Rik, 8430421H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 29809
Homologene: 8143
St6gal1
Name: beta galactoside alpha 2,6 sialyltransferase 1
Synonyms: ST6Gal I, St6Gal-I, Siat1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20440
Homologene: 2281
Trmt1l
Name: tRNA methyltransferase 1 like
Synonyms: Trm1-like, 1190005F20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98685
Homologene: 12801
Lingo2
Name: leucine rich repeat and Ig domain containing 2
Synonyms: B230217C06Rik, Lrrn6c, LERN3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242384
Homologene: 17621
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268527
Homologene: 8780
Slc6a7
Name: solute carrier family 6 (neurotransmitter transporter, L-proline), member 7
Synonyms: Prot
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240332
VEGA: 18
Homologene: 8592
Or10q1
Name: olfactory receptor family 10 subfamily Q member 1
Synonyms: GA_x6K02T2RE5P-4082427-4083374, MOR266-1, Olfr1494
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258992
Homologene: 64855
Bpifb6
Name: BPI fold containing family B, member 6
Synonyms: LOC228796, Bpil3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228796
Homologene: 18375
Hsdl2
Name: hydroxysteroid dehydrogenase like 2
Synonyms: 2610207I16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72479
Herc6
Name: hect domain and RLD 6
Synonyms: 4930427L17Rik, 1700121D12Rik, CEB1, 2510038N07Rik, Herc5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67138
Homologene: 70768
Or4k52
Name: olfactory receptor family 4 subfamily K member 52
Synonyms: GA_x6K02T2Q125-72831562-72832500, MOR248-3, Olfr1302
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258891
Homologene: 27290
Zfp52
Name: zinc finger protein 52
Synonyms: zfec29, Zfp-52, KRAB11, Zfp76
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22710
VEGA: 17
Homologene: 77326
Vmn2r14
Name: vomeronasal 2, receptor 14
Synonyms: EG231591
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231591
Homologene: 129606
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627569
Homologene: 129606
Dsn1
Name: DSN1 homolog, MIS12 kinetochore complex component
Synonyms: 1700022L09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66934
Homologene: 49806
Syne3
Name: spectrin repeat containing, nuclear envelope family member 3
Synonyms: nesprin-3beta, nesprin-3alpha, nesprin-3, 4831426I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 212073
VEGA: 12
Homologene: 17625
S1pr4
Name: sphingosine-1-phosphate receptor 4
Synonyms: lpC1, S1P4, Edg6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13611
VEGA: 10
HGNC: HGNC:3170
Homologene: 2799
Rbm12b1
Name: RNA binding motif protein 12 B1
Synonyms: 3000004N20Rik, Rbm12b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72397
Homologene: 28658
Tekt1
Name: tektin 1
Synonyms: MT14
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21689
Homologene: 7973
Dvl3
Name: dishevelled segment polarity protein 3
Synonyms: b2b2866Clo
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13544
HGNC: HGNC:3087
Homologene: 20928
Zfp2
Name: zinc finger protein 2
Synonyms: mkr-2, Zfp-2, Fnp-2, 9930007F06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22678
Homologene: 121779
Cyp4a14
Name: cytochrome P450, family 4, subfamily a, polypeptide 14
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13119
Homologene: 134697
Krtap5-2
Name: keratin associated protein 5-2
Synonyms: 4833428E21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71623
Slc22a12
Name: solute carrier family 22 (organic anion/cation transporter), member 12
Synonyms: Rst, URAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20521
Homologene: 56442
Epm2a
Name: epilepsy, progressive myoclonic epilepsy, type 2 gene alpha
Synonyms: laforin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13853
HGNC: HGNC:3413
Homologene: 38087
Or4k1
Name: olfactory receptor family 4 subfamily K member 1
Synonyms: GA_x6K02T2PMLR-5831021-5830086, MOR246-1P, Olfr728
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258039
Homologene: 74224
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13318, Gm13364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Igkv1-110
Name: immunoglobulin kappa variable 1-110
Synonyms: Gm16634
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381777
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 14,912,401 bp
  • T to C, chromosome 1 at 105,731,261 bp
  • T to A, chromosome 1 at 139,237,690 bp
  • T to C, chromosome 1 at 151,440,888 bp
  • T to C, chromosome 1 at 160,682,103 bp
  • A to G, chromosome 1 at 171,216,827 bp
  • A to G, chromosome 2 at 13,010,672 bp
  • G to A, chromosome 2 at 15,614,215 bp
  • C to T, chromosome 2 at 29,930,624 bp
  • T to C, chromosome 2 at 34,700,822 bp
  • A to T, chromosome 2 at 111,780,448 bp
  • T to A, chromosome 2 at 153,208,743 bp
  • T to A, chromosome 2 at 153,903,009 bp
  • T to A, chromosome 2 at 156,997,716 bp
  • G to T, chromosome 4 at 12,145,954 bp
  • T to A, chromosome 4 at 35,709,248 bp
  • G to T, chromosome 4 at 59,612,724 bp
  • G to T, chromosome 4 at 63,834,446 bp
  • A to T, chromosome 4 at 115,493,609 bp
  • A to G, chromosome 4 at 123,684,303 bp
  • A to G, chromosome 5 at 24,431,668 bp
  • A to T, chromosome 5 at 109,091,749 bp
  • A to T, chromosome 5 at 109,220,458 bp
  • G to A, chromosome 5 at 109,737,504 bp
  • T to A, chromosome 5 at 110,331,041 bp
  • C to T, chromosome 6 at 54,300,171 bp
  • T to G, chromosome 6 at 57,659,817 bp
  • C to T, chromosome 6 at 68,270,990 bp
  • T to A, chromosome 6 at 119,761,188 bp
  • G to A, chromosome 7 at 30,663,253 bp
  • T to A, chromosome 7 at 125,632,555 bp
  • C to T, chromosome 7 at 142,174,962 bp
  • ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG to ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG, chromosome 7 at 142,296,596 bp
  • T to A, chromosome 8 at 27,462,024 bp
  • T to C, chromosome 8 at 64,597,528 bp
  • T to A, chromosome 8 at 104,966,330 bp
  • A to G, chromosome 8 at 126,939,883 bp
  • A to G, chromosome 10 at 11,390,940 bp
  • G to T, chromosome 10 at 14,127,670 bp
  • T to A, chromosome 10 at 28,496,924 bp
  • A to G, chromosome 10 at 63,269,678 bp
  • A to T, chromosome 10 at 81,499,021 bp
  • T to A, chromosome 10 at 127,300,575 bp
  • T to C, chromosome 11 at 50,900,778 bp
  • T to A, chromosome 11 at 55,007,899 bp
  • T to A, chromosome 11 at 72,359,718 bp
  • T to C, chromosome 11 at 98,993,814 bp
  • T to C, chromosome 11 at 100,591,561 bp
  • C to A, chromosome 12 at 16,740,121 bp
  • T to C, chromosome 12 at 65,126,547 bp
  • T to C, chromosome 12 at 104,954,287 bp
  • T to G, chromosome 14 at 37,089,380 bp
  • T to C, chromosome 14 at 50,140,346 bp
  • C to T, chromosome 14 at 72,440,673 bp
  • A to G, chromosome 15 at 12,374,016 bp
  • C to T, chromosome 15 at 91,767,324 bp
  • A to T, chromosome 15 at 98,658,434 bp
  • A to T, chromosome 16 at 20,527,250 bp
  • T to C, chromosome 16 at 23,321,035 bp
  • A to G, chromosome 16 at 45,104,525 bp
  • A to G, chromosome 16 at 94,114,960 bp
  • T to C, chromosome 16 at 96,027,368 bp
  • T to C, chromosome 17 at 21,560,990 bp
  • T to C, chromosome 18 at 37,727,417 bp
  • T to C, chromosome 18 at 61,000,423 bp
  • C to A, chromosome 19 at 6,537,169 bp
  • T to C, chromosome 19 at 13,749,964 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7740 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045796-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.