Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7749Btlr/Mmmh
Stock Number:
045805-MU
Citation ID:
RRID:MMRRC_045805-MU
Other Names:
R7749 (G1)
Major Collection:

Strain Information

Htr5b
Name: 5-hydroxytryptamine (serotonin) receptor 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15564
Homologene: 74951
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Fgd4
Name: FYVE, RhoGEF and PH domain containing 4
Synonyms: Frabin-gamma, Frabin-beta, Frabin-alpha, Frabin, 9330209B17Rik, ZFYVE6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224014
Homologene: 26727
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 74,565,133 bp
  • A to T, chromosome 1 at 106,018,273 bp
  • G to T, chromosome 1 at 121,527,758 bp
  • A to G, chromosome 1 at 126,024,646 bp
  • A to T, chromosome 1 at 134,390,512 bp
  • A to C, chromosome 1 at 192,277,139 bp
  • C to A, chromosome 2 at 31,453,033 bp
  • T to C, chromosome 2 at 76,776,315 bp
  • G to A, chromosome 2 at 87,949,478 bp
  • A to G, chromosome 2 at 103,771,754 bp
  • T to A, chromosome 2 at 164,617,419 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • T to A, chromosome 3 at 27,207,382 bp
  • C to T, chromosome 3 at 38,482,721 bp
  • T to A, chromosome 3 at 59,329,128 bp
  • A to G, chromosome 3 at 89,316,640 bp
  • T to G, chromosome 3 at 106,148,845 bp
  • T to A, chromosome 4 at 40,949,488 bp
  • G to A, chromosome 4 at 114,907,812 bp
  • T to C, chromosome 4 at 118,690,228 bp
  • A to T, chromosome 4 at 137,650,417 bp
  • T to A, chromosome 5 at 34,307,940 bp
  • T to G, chromosome 5 at 108,336,296 bp
  • T to C, chromosome 5 at 109,086,054 bp
  • T to A, chromosome 5 at 115,548,516 bp
  • C to T, chromosome 5 at 120,611,441 bp
  • A to G, chromosome 6 at 18,879,516 bp
  • T to A, chromosome 6 at 29,380,169 bp
  • A to T, chromosome 6 at 64,729,920 bp
  • T to C, chromosome 6 at 68,050,188 bp
  • A to T, chromosome 6 at 83,186,141 bp
  • G to A, chromosome 7 at 29,178,921 bp
  • A to T, chromosome 7 at 44,962,265 bp
  • A to G, chromosome 7 at 79,679,096 bp
  • G to A, chromosome 7 at 134,224,813 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • G to A, chromosome 9 at 88,569,870 bp
  • G to C, chromosome 9 at 108,336,715 bp
  • T to C, chromosome 10 at 109,703,352 bp
  • T to C, chromosome 10 at 115,376,384 bp
  • T to C, chromosome 11 at 3,242,608 bp
  • A to G, chromosome 11 at 6,419,569 bp
  • T to A, chromosome 11 at 65,911,830 bp
  • T to G, chromosome 11 at 97,267,628 bp
  • T to C, chromosome 11 at 98,657,721 bp
  • A to G, chromosome 11 at 121,054,942 bp
  • A to T, chromosome 12 at 30,226,911 bp
  • A to G, chromosome 12 at 83,801,277 bp
  • A to T, chromosome 12 at 84,442,081 bp
  • A to G, chromosome 13 at 8,569,739 bp
  • T to C, chromosome 13 at 38,221,287 bp
  • C to T, chromosome 14 at 70,492,844 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 15 at 34,276,200 bp
  • C to A, chromosome 15 at 44,527,737 bp
  • T to A, chromosome 15 at 76,499,187 bp
  • T to C, chromosome 16 at 16,475,154 bp
  • T to C, chromosome 16 at 17,528,603 bp
  • A to T, chromosome 16 at 95,377,357 bp
  • A to G, chromosome 17 at 18,136,278 bp
  • T to A, chromosome 17 at 26,959,964 bp
  • T to A, chromosome 17 at 28,038,141 bp
  • T to A, chromosome 17 at 29,705,273 bp
  • A to G, chromosome 17 at 51,767,933 bp
  • T to A, chromosome 17 at 80,238,858 bp
  • G to T, chromosome 18 at 46,524,118 bp
  • A to G, chromosome 19 at 8,621,896 bp
  • T to C, chromosome 19 at 8,820,424 bp
  • A to T, chromosome 19 at 12,680,212 bp
  • A to T, chromosome 19 at 46,379,747 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7749 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045805-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.