Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7749Btlr/Mmmh
Stock Number:
045805-MU
Citation ID:
RRID:MMRRC_045805-MU
Other Names:
R7749 (G1)
Major Collection:

Strain Information

Htr5b
Name: 5-hydroxytryptamine (serotonin) receptor 5B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15564
Homologene: 74951
Satb1
Name: special AT-rich sequence binding protein 1
Synonyms: 2610306G12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20230
Homologene: 2232
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Fgd4
Name: FYVE, RhoGEF and PH domain containing 4
Synonyms: Frabin-gamma, Frabin-beta, Frabin-alpha, Frabin, 9330209B17Rik, ZFYVE6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224014
Homologene: 26727
Anks1
Name: ankyrin repeat and SAM domain containing 1
Synonyms: Odin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224650
Homologene: 9068
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Ticrr
Name: TOPBP1-interacting checkpoint and replication regulator
Synonyms: 5730590G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77011
Homologene: 67120
Dctn1
Name: dynactin 1
Synonyms: Glued, p150, p150glued
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13191
HGNC: HGNC:2711
Homologene: 3011
Cpt1c
Name: carnitine palmitoyltransferase 1c
Synonyms: CPT I-C, 9630004I06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78070
Homologene: 17561
Taf4
Name: TATA-box binding protein associated factor 4
Synonyms: Taf2c1, TAFII135, TAFII130, Taf4a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228980
Homologene: 55723
Eif4enif1
Name: eukaryotic translation initiation factor 4E nuclear import factor 1
Synonyms: Clast4, 2610509L04Rik, D11Ertd166e, A930019J01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74203
Homologene: 10522
Laptm4b
Name: lysosomal-associated protein transmembrane 4B
Synonyms: C330023P13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 114128
VEGA: 15
Homologene: 10182
Rhoa
Name: ras homolog family member A
Synonyms: RhoA, Arha2, Arha1, Arha
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11848
HGNC: HGNC:667
Homologene: 68986
Caprin1
Name: cell cycle associated protein 1
Synonyms: MMGPIP137, Gpiap1, caprin-1, RNG105
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53872
HGNC: HGNC:6743
Homologene: 4310
Actr1a
Name: ARP1 actin-related protein 1A, centractin alpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54130
VEGA: 19
HGNC: HGNC:167
Homologene: 21173
Npepps
Name: aminopeptidase puromycin sensitive
Synonyms: MP100, Psa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19155
HGNC: HGNC:7900
Homologene: 36199
Chmp5
Name: charged multivesicular body protein 5
Synonyms: 2210412K09Rik, chromatin modifying protein 5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76959
Homologene: 5757
Ccdc167
Name: coiled-coil domain containing 167
Synonyms: 1110021J02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68597
Homologene: 79796
Hsf1
Name: heat shock factor 1
Synonyms: heat shock transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15499
VEGA: 15
HGNC: HGNC:5224
Homologene: 74556
Atoh1
Name: atonal bHLH transcription factor 1
Synonyms: Math1, Hath1, bHLHa14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11921
HGNC: HGNC:797
Homologene: 31297
Bmp1
Name: bone morphogenetic protein 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12153
VEGA: 14
HGNC: HGNC:1067
Homologene: 55955
Numb
Name: NUMB endocytic adaptor protein
Synonyms: m-numb
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18222
HGNC: HGNC:8060
Homologene: 2775
Adam12
Name: ADAM metallopeptidase domain 12
Synonyms: Mltna, ADAM12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11489
HGNC: HGNC:190
Homologene: 74862
Syngap1
Name: synaptic Ras GTPase activating protein 1 homolog (rat)
Synonyms: Syngap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240057
Homologene: 84739
Snrnp48
Name: small nuclear ribonucleoprotein 48 (U11/U12)
Synonyms: 1110050F08Rik, 6530403A03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67797
VEGA: 13
Homologene: 12191
Hnrnpul2
Name: heterogeneous nuclear ribonucleoprotein U-like 2
Synonyms: 1110031M08Rik, Hnrpul2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68693
VEGA: 19
Homologene: 28583
Zfp949
Name: zinc finger protein 949
Synonyms: 4930422I07Rik, Nczf
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71640
Homologene: 129930
Nceh1
Name: neutral cholesterol ester hydrolase 1
Synonyms: CPO-BP, mKIAA1363, B230106I24Rik, Aadacl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320024
Homologene: 23251
Zcchc2
Name: zinc finger, CCHC domain containing 2
Synonyms: 9930114B20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227449
Homologene: 9808
Fem1c
Name: fem 1 homolog c
Synonyms: 3632443A22Rik, 2610312A07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240263
Homologene: 10606
Mgat4f
Name: MGAT4 family, member F
Synonyms: 4933406M09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240755
Homologene: 128441
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Plcd4
Name: phospholipase C, delta 4
Synonyms: 4921507K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18802
HGNC: HGNC:9062
Homologene: 88782
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dhx57
Name: DExH-box helicase 57
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106794
VEGA: 17
Homologene: 56267
Pigg
Name: phosphatidylinositol glycan anchor biosynthesis, class G
Synonyms: Gpi7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433931
Homologene: 39421
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Nav3
Name: neuron navigator 3
Synonyms: Pomfil1p, POMFIL1, 4732483H20Rik, unc53H3, steerin 3, 9630020C08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 260315
Homologene: 56688
Aldh6a1
Name: aldehyde dehydrogenase family 6, subfamily A1
Synonyms: 1110038I05Rik, Mmsdh
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104776
VEGA: 12
HGNC: HGNC:7179
Homologene: 4082
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: D11Ertd686e, Dnahc9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Wfdc6b
Name: WAP four-disulfide core domain 6B
Synonyms: Wfdc6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 433502
Homologene: 79014
Ankrd7
Name: ankyrin repeat domain 7
Synonyms: 4930532L20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75196
Homologene: 35506
Nckap5
Name: NCK-associated protein 5
Synonyms: LOC380609, D130011D22Rik, E030049G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210356
Homologene: 35542
Ankrd50
Name: ankyrin repeat domain 50
Synonyms: E430012K20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99696
Homologene: 129859
Igsf10
Name: immunoglobulin superfamily, member 10
Synonyms: 6530405F15Rik, CMF608, Adlican2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242050
Homologene: 18712
Thap2
Name: THAP domain containing, apoptosis associated protein 2
Synonyms: 2900040O07Rik, 9030625G08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66816
VEGA: 10
Homologene: 12039
Gsdma2
Name: gasdermin A2
Synonyms: 2210411P14Rik, 2210009F20Rik, 2200001G21Rik, Gsdml2, 2210006M16Rik, Gsdm2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76758
Sntg2
Name: syntrophin, gamma 2
Synonyms: 2210008K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268534
Homologene: 41298
Chil3
Name: chitinase-like 3
Synonyms: Ym1, Chi3l3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12655
Homologene: 74931
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665210
Homologene: 115024
Kcnh1
Name: potassium voltage-gated channel, subfamily H (eag-related), member 1
Synonyms: ether a go-go, Eag1, Kv10.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16510
HGNC: HGNC:6250
Homologene: 68242
Sectm1b
Name: secreted and transmembrane 1B
Synonyms: K12, 1810003C24Rik, Sectm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58210
Homologene: 86740
Or5l13
Name: olfactory receptor family 5 subfamily L member 13
Synonyms: GA_x6K02T2Q125-49433499-49432537, MOR174-3, Olfr1156
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258814
HGNC: HGNC:8351
Homologene: 72031
Adarb2
Name: adenosine deaminase, RNA-specific, B2
Synonyms: RED2, Adar3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94191
HGNC: HGNC:227
Homologene: 10276
Rita1
Name: RBPJ interacting and tubulin associated 1
Synonyms: 1110008J03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100764
Homologene: 12585
Vmn2r12
Name: vomeronasal 2, receptor 12
Synonyms: Gm6769
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 627569
Homologene: 129606
Psmd8
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 8
Synonyms: 6720456J22Rik, C76433
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57296
HGNC: HGNC:9566
Homologene: 37686
Opn1sw
Name: opsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
Synonyms: Blue/UV Opsin, Blue Opsin, SWS opsin, Short Wavelength Sensitive opsin, S Opsin, Blue Cone Opsin, Bcp, UV cone pigment
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12057
HGNC: HGNC:1012
Homologene: 1291
Or13p4
Name: olfactory receptor family 13 subfamily P member 4
Synonyms: GA_x6K02T2QD9B-18856980-18857927, MOR258-3, Olfr1342
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258708
Homologene: 17357
Efna3
Name: ephrin A3
Synonyms: Epl3, LERK-3, EFL-2, Ehk1-L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13638
HGNC: HGNC:3223
Homologene: 3635
Slc22a6
Name: solute carrier family 22 (organic anion transporter), member 6
Synonyms: NKT, Oat1, Orctl1, mOat1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18399
VEGA: 19
Homologene: 16813
Foxd2
Name: forkhead box D2
Synonyms: Mf2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17301
HGNC: HGNC:3803
Homologene: 3292
Thap7
Name: THAP domain containing 7
Synonyms: 1810004B07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69009
Homologene: 12293
Or5b95
Name: olfactory receptor family 5 subfamily B member 95
Synonyms: GA_x6K02T2RE5P-3006492-3007430, MOR202-8, Olfr1443
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258693
HGNC: HGNC:8324
Homologene: 115496
Igkv9-120
Name: immunoglobulin kappa chain variable 9-120
Synonyms: Gm5571
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 434025
Ppia
Name: peptidylprolyl isomerase A
Synonyms: cyclophilin A, CyP-18, Cphn, CypA
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268373
HGNC: HGNC:9253
Homologene: 134504
Cfap99
Name: cilia and flagella associated protein 99
Synonyms: Gm21446
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862066
Homologene: 82544
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 74,565,133 bp
  • A to T, chromosome 1 at 106,018,273 bp
  • G to T, chromosome 1 at 121,527,758 bp
  • A to G, chromosome 1 at 126,024,646 bp
  • A to T, chromosome 1 at 134,390,512 bp
  • A to C, chromosome 1 at 192,277,139 bp
  • C to A, chromosome 2 at 31,453,033 bp
  • T to C, chromosome 2 at 76,776,315 bp
  • G to A, chromosome 2 at 87,949,478 bp
  • A to G, chromosome 2 at 103,771,754 bp
  • T to A, chromosome 2 at 164,617,419 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • T to A, chromosome 3 at 27,207,382 bp
  • C to T, chromosome 3 at 38,482,721 bp
  • T to A, chromosome 3 at 59,329,128 bp
  • A to G, chromosome 3 at 89,316,640 bp
  • T to G, chromosome 3 at 106,148,845 bp
  • T to A, chromosome 4 at 40,949,488 bp
  • G to A, chromosome 4 at 114,907,812 bp
  • T to C, chromosome 4 at 118,690,228 bp
  • A to T, chromosome 4 at 137,650,417 bp
  • T to A, chromosome 5 at 34,307,940 bp
  • T to G, chromosome 5 at 108,336,296 bp
  • T to C, chromosome 5 at 109,086,054 bp
  • T to A, chromosome 5 at 115,548,516 bp
  • C to T, chromosome 5 at 120,611,441 bp
  • A to G, chromosome 6 at 18,879,516 bp
  • T to A, chromosome 6 at 29,380,169 bp
  • A to T, chromosome 6 at 64,729,920 bp
  • T to C, chromosome 6 at 68,050,188 bp
  • A to T, chromosome 6 at 83,186,141 bp
  • G to A, chromosome 7 at 29,178,921 bp
  • A to T, chromosome 7 at 44,962,265 bp
  • A to G, chromosome 7 at 79,679,096 bp
  • G to A, chromosome 7 at 134,224,813 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • G to A, chromosome 9 at 88,569,870 bp
  • G to C, chromosome 9 at 108,336,715 bp
  • T to C, chromosome 10 at 109,703,352 bp
  • T to C, chromosome 10 at 115,376,384 bp
  • T to C, chromosome 11 at 3,242,608 bp
  • A to G, chromosome 11 at 6,419,569 bp
  • T to A, chromosome 11 at 65,911,830 bp
  • T to G, chromosome 11 at 97,267,628 bp
  • T to C, chromosome 11 at 98,657,721 bp
  • A to G, chromosome 11 at 121,054,942 bp
  • A to T, chromosome 12 at 30,226,911 bp
  • A to G, chromosome 12 at 83,801,277 bp
  • A to T, chromosome 12 at 84,442,081 bp
  • A to G, chromosome 13 at 8,569,739 bp
  • T to C, chromosome 13 at 38,221,287 bp
  • C to T, chromosome 14 at 70,492,844 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 15 at 34,276,200 bp
  • C to A, chromosome 15 at 44,527,737 bp
  • T to A, chromosome 15 at 76,499,187 bp
  • T to C, chromosome 16 at 16,475,154 bp
  • T to C, chromosome 16 at 17,528,603 bp
  • A to T, chromosome 16 at 95,377,357 bp
  • A to G, chromosome 17 at 18,136,278 bp
  • T to A, chromosome 17 at 26,959,964 bp
  • T to A, chromosome 17 at 28,038,141 bp
  • T to A, chromosome 17 at 29,705,273 bp
  • A to G, chromosome 17 at 51,767,933 bp
  • T to A, chromosome 17 at 80,238,858 bp
  • G to T, chromosome 18 at 46,524,118 bp
  • A to G, chromosome 19 at 8,621,896 bp
  • T to C, chromosome 19 at 8,820,424 bp
  • A to T, chromosome 19 at 12,680,212 bp
  • A to T, chromosome 19 at 46,379,747 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7749 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045805-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text