Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7751Btlr/Mmmh
Stock Number:
045807-MU
Citation ID:
RRID:MMRRC_045807-MU
Other Names:
R7751 (G1)
Major Collection:

Strain Information

Lrig2
Name: leucine-rich repeats and immunoglobulin-like domains 2
Synonyms: 4632419I10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269473
Homologene: 8882
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Kansl1
Name: KAT8 regulatory NSL complex subunit 1
Synonyms: 1700081L11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76719
Homologene: 9140
Agrn
Name: agrin
Synonyms: NMF380, Agrin, nmf380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 20,200,925 bp
  • A to G, chromosome 1 at 23,762,864 bp
  • G to A, chromosome 1 at 40,123,211 bp
  • G to A, chromosome 1 at 52,082,552 bp
  • A to G, chromosome 1 at 58,179,335 bp
  • G to A, chromosome 1 at 89,968,484 bp
  • G to T, chromosome 1 at 91,494,757 bp
  • A to G, chromosome 1 at 106,949,671 bp
  • A to T, chromosome 1 at 150,104,507 bp
  • A to G, chromosome 1 at 150,419,895 bp
  • A to T, chromosome 1 at 155,129,308 bp
  • A to T, chromosome 1 at 157,558,060 bp
  • G to A, chromosome 1 at 171,383,758 bp
  • A to C, chromosome 1 at 173,332,212 bp
  • C to T, chromosome 2 at 13,360,365 bp
  • T to C, chromosome 2 at 23,187,844 bp
  • A to G, chromosome 2 at 85,753,492 bp
  • A to T, chromosome 2 at 91,383,773 bp
  • C to A, chromosome 2 at 129,460,447 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • G to A, chromosome 3 at 33,809,441 bp
  • A to G, chromosome 3 at 51,257,614 bp
  • A to T, chromosome 3 at 68,697,902 bp
  • A to T, chromosome 3 at 104,494,669 bp
  • G to A, chromosome 3 at 151,492,309 bp
  • C to T, chromosome 3 at 154,763,789 bp
  • T to A, chromosome 4 at 86,828,942 bp
  • T to C, chromosome 4 at 88,629,119 bp
  • T to C, chromosome 4 at 144,109,217 bp
  • T to A, chromosome 4 at 150,143,134 bp
  • T to C, chromosome 4 at 151,148,406 bp
  • T to C, chromosome 4 at 154,328,299 bp
  • C to T, chromosome 4 at 156,176,429 bp
  • T to C, chromosome 5 at 33,133,417 bp
  • G to A, chromosome 5 at 77,351,287 bp
  • T to C, chromosome 5 at 110,809,212 bp
  • T to C, chromosome 5 at 137,365,675 bp
  • A to C, chromosome 5 at 145,220,866 bp
  • A to G, chromosome 6 at 58,435,412 bp
  • A to C, chromosome 6 at 72,359,045 bp
  • A to T, chromosome 6 at 141,834,687 bp
  • T to C, chromosome 6 at 149,017,106 bp
  • A to G, chromosome 6 at 149,325,438 bp
  • T to A, chromosome 7 at 3,895,604 bp
  • C to T, chromosome 7 at 12,176,835 bp
  • T to C, chromosome 7 at 24,899,667 bp
  • A to T, chromosome 7 at 120,365,821 bp
  • A to G, chromosome 7 at 139,089,540 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • A to T, chromosome 8 at 13,568,708 bp
  • A to G, chromosome 8 at 95,538,201 bp
  • T to A, chromosome 8 at 105,452,035 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 8 at 110,880,968 bp
  • C to A, chromosome 8 at 119,869,658 bp
  • T to A, chromosome 9 at 48,743,469 bp
  • A to T, chromosome 9 at 86,507,730 bp
  • G to A, chromosome 9 at 121,964,821 bp
  • T to A, chromosome 10 at 13,527,806 bp
  • A to C, chromosome 10 at 18,169,405 bp
  • C to A, chromosome 10 at 31,517,419 bp
  • A to G, chromosome 11 at 22,973,595 bp
  • A to T, chromosome 11 at 49,970,293 bp
  • A to T, chromosome 11 at 73,453,546 bp
  • A to G, chromosome 11 at 77,049,271 bp
  • A to T, chromosome 11 at 90,387,995 bp
  • T to A, chromosome 11 at 94,565,173 bp
  • A to G, chromosome 11 at 104,424,064 bp
  • A to T, chromosome 11 at 107,479,613 bp
  • A to G, chromosome 11 at 115,253,870 bp
  • T to C, chromosome 11 at 116,677,584 bp
  • A to T, chromosome 12 at 31,487,580 bp
  • G to T, chromosome 12 at 86,883,715 bp
  • T to A, chromosome 12 at 111,992,548 bp
  • G to A, chromosome 13 at 49,078,017 bp
  • G to A, chromosome 13 at 55,593,241 bp
  • A to T, chromosome 14 at 79,770,703 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 15 at 66,449,563 bp
  • T to G, chromosome 15 at 78,341,639 bp
  • C to A, chromosome 15 at 102,109,728 bp
  • T to A, chromosome 16 at 35,102,064 bp
  • A to T, chromosome 17 at 47,016,874 bp
  • G to T, chromosome 17 at 48,346,539 bp
  • A to G, chromosome 17 at 52,961,843 bp
  • C to T, chromosome 17 at 87,640,476 bp
  • T to A, chromosome 19 at 4,103,470 bp
  • A to G, chromosome 19 at 59,344,776 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7751 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045807-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.