Strain Name:
C57BL/6J-MtgxR7751Btlr/Mmmh
Stock Number:
045807-MU
Citation ID:
RRID:MMRRC_045807-MU
Other Names:
R7751 (G1)
Major Collection:

Strain Information

Lrig2
Name: leucine-rich repeats and immunoglobulin-like domains 2
Synonyms: 4632419I10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269473
Homologene: 8882
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, csp1, 5730557K01Rik, line 27
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, 4921505C17Rik, D530039E11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Ulk1
Name: unc-51 like kinase 1
Synonyms: Unc51.1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22241
Homologene: 2640
Kansl1
Name: KAT8 regulatory NSL complex subunit 1
Synonyms: 1700081L11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76719
Homologene: 9140
Agrn
Name: agrin
Synonyms: nmf380, Agrin, NMF380
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11603
HGNC: HGNC:329
Homologene: 27907
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Tpr
Name: translocated promoter region, nuclear basket protein
Synonyms: 2610029M07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108989
Homologene: 37753
Taf4
Name: TATA-box binding protein associated factor 4
Synonyms: TAFII130, Taf2c1, Taf4a, TAFII135
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228980
Homologene: 55723
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: Dopey1, D9Ertd809e, B130005I07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Traf3ip1
Name: TRAF3 interacting protein 1
Synonyms: 3930402D05Rik, MIP-T3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74019
Homologene: 22913
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Psmd12
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 12
Synonyms: 1500002F15Rik, P55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66997
HGNC: HGNC:9557
Homologene: 2109
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329877
Homologene: 23057
Epcam
Name: epithelial cell adhesion molecule
Synonyms: Ep-CAM, CD326, EGP-2, GA733-2, panepithelial glycoprotein 314, TROP1, Tacstd1, Egp314, Ly74, gp40, EpCAM, EpCAM1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17075
VEGA: 17
Homologene: 1764
Cog4
Name: component of oligomeric golgi complex 4
Synonyms: D8Ertd515e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102339
Homologene: 7155
Zkscan5
Name: zinc finger with KRAB and SCAN domains 5
Synonyms: hKraba1, Zfp95
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22757
Homologene: 8734
Ackr1
Name: atypical chemokine receptor 1 (Duffy blood group)
Synonyms: CCBP1, Dfy, ESTM35, Darc, CD234, FY
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13349
HGNC: HGNC:4035
Homologene: 48067
Cd79a
Name: CD79A antigen (immunoglobulin-associated alpha)
Synonyms: Ly54, Iga, Igalpha, Ly-54, Cd79a, mb-1, Ig alpha, Ig-alpha
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12518
HGNC: HGNC:1698
Homologene: 31053
Grin2c
Name: glutamate receptor, ionotropic, NMDA2C (epsilon 3)
Synonyms: NMDAR2C, NR2C, GluRepsilon3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14813
HGNC: HGNC:4587
Homologene: 647
Camta1
Name: calmodulin binding transcription activator 1
Synonyms: 1810059M14Rik, 2310058O09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100072
Homologene: 18942
Rasa3
Name: RAS p21 protein activator 3
Synonyms: hlb381, GAPIII activator 3, GAPIII, Ras GTPase-activating protein III, scat, R-Ras gap
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19414
Homologene: 7217
Zbtb16
Name: zinc finger and BTB domain containing 16
Synonyms: Green's luxoid, Zfp145, PLZF
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235320
VEGA: 9
Homologene: 21214
Adgrl4
Name: adhesion G protein-coupled receptor L4
Synonyms: Eltd1, EGF-TM7 receptor, 1110033N21Rik, Etl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170757
Homologene: 11170
Yme1l1
Name: YME1-like 1 (S. cerevisiae)
Synonyms: Ftsh, ATP-dependent metalloprotease FtsH1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27377
Homologene: 31996
Elf2
Name: E74-like factor 2
Synonyms: NERF-2, 2610036A20Rik, A230104O07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69257
HGNC: HGNC:3317
Homologene: 5006
St6galnac2
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Synonyms: ST6GalNAc II, Siat7b, Siat7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20446
Homologene: 4714
B3gat2
Name: beta-1,3-glucuronyltransferase 2
Synonyms: GlcAT-S
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 280645
HGNC: HGNC:922
Homologene: 50574
Ptgs2
Name: prostaglandin-endoperoxide synthase 2
Synonyms: prostaglandin G/H synthase, COX2, PGHS-2, Tis10, cyclooxygenase-2, PHS-2, cyclooxygenase 2, Cox-2, Pghs2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19225
HGNC: HGNC:9605
Homologene: 31000
Pitpnm1
Name: phosphatidylinositol transfer protein, membrane-associated 1
Synonyms: DRES9, RdgB
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18739
HGNC: HGNC:9003
Homologene: 3608
Cubn
Name: cubilin
Synonyms: intrinsic factor-cobalamin receptor, D2Wsu88e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Igfbp7
Name: insulin-like growth factor binding protein 7
Synonyms: mac25, Fstl2, AGM
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 29817
HGNC: HGNC:5476
Homologene: 1193
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Dennd5b
Name: DENN domain containing 5B
Synonyms: 9330160C06Rik, D030011O10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320560
Homologene: 44911
Tns2
Name: tensin 2
Synonyms: Tenc1, nph, nep
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 209039
VEGA: 15
Homologene: 37077
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Dpysl4
Name: dihydropyrimidinase-like 4
Synonyms: DPY4, CRMP-3, Drp-4, Ulip4, unc-33-like phosphoprotein 4, Crmp3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26757
HGNC: HGNC:3016
Homologene: 4691
Stat4
Name: signal transducer and activator of transcription 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20849
Homologene: 20679
Pdzd8
Name: PDZ domain containing 8
Synonyms: Pdzk8, A630041P07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Il1r2
Name: interleukin 1 receptor, type II
Synonyms: CD121b, Il1r-2, IL-1 receptor beta chain
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16178
HGNC: HGNC:5994
Homologene: 7783
Abca15
Name: ATP-binding cassette, sub-family A member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320631
Homologene: 87255
Wnk2
Name: WNK lysine deficient protein kinase 2
Synonyms: 1810073P09Rik, X83337, ESTM15
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75607
Homologene: 19155
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: C330021H03Rik, Gm10331
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Hacd2
Name: 3-hydroxyacyl-CoA dehydratase 2
Synonyms: 6330408J20Rik, Ptplb
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70757
VEGA: 16
HGNC: HGNC:9640
Homologene: 23409
F830045P16Rik
Name: RIKEN cDNA F830045P16 gene
Synonyms: Sirpb3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228592
Homologene: 136180
Slco1a4
Name: solute carrier organic anion transporter family, member 1a4
Synonyms: Slc21a5, Oatp1a4, Oatp2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28250
Homologene: 130782
Tmem150a
Name: transmembrane protein 150A
Synonyms: Tmem150
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232086
Homologene: 16378
Aox3
Name: aldehyde oxidase 3
Synonyms: 1200011D03Rik, AOH1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71724
Homologene: 90899
Pex3
Name: peroxisomal biogenesis factor 3
Synonyms: 1700014F15Rik, 2900010N04Rik, 2810027F19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56535
HGNC: HGNC:8858
Homologene: 2691
Dnaaf11
Name: dynein axonemal assembly factor 11
Synonyms: LRTP, Lrrc6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54562
Homologene: 34534
Pcdh8
Name: protocadherin 8
Synonyms: Papc, 1700080P15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18530
HGNC: HGNC:8660
Homologene: 1943
Csf2rb
Name: colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)
Synonyms: AIC2B, common beta chain, Il5rb, Il3rb1, Bc, Csf2rb1, beta c, CDw131, Il3r
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12983
VEGA: 15
HGNC: HGNC:2436
Homologene: 339
Slc5a1
Name: solute carrier family 5 (sodium/glucose cotransporter), member 1
Synonyms: sodium glucose cotransporter 1, Sglt1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20537
Homologene: 55456
Ttc14
Name: tetratricopeptide repeat domain 14
Synonyms: 4933402I15Rik, 4931403I22Rik, 2700016E08Rik, cI-44, 4930434D01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67120
Homologene: 12085
Sec16b
Name: SEC16 homolog B, endoplasmic reticulum export factor
Synonyms: Rgpr-p117, Lztr2, Rgpr
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 89867
Homologene: 13227
Irf2bpl
Name: interferon regulatory factor 2 binding protein-like
Synonyms: 6430527G18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238330
VEGA: 12
Homologene: 11555
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: C130090D05Rik, ELK1, Kv12.1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Cstpp1
Name: centriolar satellite-associated tubulin polyglutamylase complex regulator 1
Synonyms: 1110051M20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228356
Homologene: 11471
Hlf
Name: hepatic leukemia factor
Synonyms: E230015K02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217082
HGNC: HGNC:4977
Homologene: 31074
Rasgef1c
Name: RasGEF domain family, member 1C
Synonyms: 9130006A14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74563
Homologene: 17918
Or1e21
Name: olfactory receptor family 1 subfamily E member 21
Synonyms: GA_x6K02T2P1NL-3613021-3612086, MOR135-1, Olfr380
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259027
Homologene: 74109
Vmn1r30
Name: vomeronasal 1 receptor 30
Synonyms: V1rc22, V1rc9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171195
Homologene: 137652
Serpinb12
Name: serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 12
Synonyms: 2300003F07Rik, 4833409F13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71869
Homologene: 23631
Il12a
Name: interleukin 12a
Synonyms: IL-12p35, p35
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16159
HGNC: HGNC:5969
Homologene: 681
Cbll1
Name: Casitas B-lineage lymphoma-like 1
Synonyms: Hakai, c-Cbl-like
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104836
Homologene: 11734
Or9g3
Name: olfactory receptor family 9 subfamily G member 3
Synonyms: MOR213-6, Olfr1012, GA_x6K02T2Q125-47239120-47238185
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258561
Homologene: 64889
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
Gask1a
Name: golgi associated kinase 1A
Synonyms: Fam198a, C730027P07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245050
VEGA: 9
Homologene: 18620
Asb18
Name: ankyrin repeat and SOCS box-containing 18
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 208372
Homologene: 16382
Rnf217
Name: ring finger protein 217
Synonyms: Ibrdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268291
Homologene: 66368
Ephb4
Name: Eph receptor B4
Synonyms: Htk, MDK2, b2b2412Clo, Myk1, Tyro11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13846
HGNC: HGNC:3395
Homologene: 20939
Mr1
Name: major histocompatibility complex, class I-related
Synonyms: MR1, H2ls
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15064
HGNC: HGNC:4975
Homologene: 123981
Slc2a5
Name: solute carrier family 2 (facilitated glucose transporter), member 5
Synonyms: GLUT5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56485
Homologene: 74459
Vmn1r79
Name: vomeronasal 1 receptor 79
Synonyms: Gm9807
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042437
Homologene: 128342
Erich3
Name: glutamate rich 3
Synonyms: 5031409G23Rik, 4922501L14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 209601
Homologene: 27877
Ccdc113
Name: coiled-coil domain containing 113
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244608
Homologene: 40927
Chad
Name: chondroadherin
Synonyms: SLRR4A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12643
HGNC: HGNC:1909
Homologene: 36063
Gm16494
Name: predicted gene 16494
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 105246356
VEGA: 17
Zrsr2-ps1
Name: zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2, pseudogene 1
Synonyms: U2afbp-rs, Zrsr1, SP2, Irlgs2, 35kDa, D11Ncvs75, U2af1-rs1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22183
Homologene: 84793
Lrrc36
Name: leucine rich repeat containing 36
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270091
Homologene: 23090
Nectin4
Name: nectin cell adhesion molecule 4
Synonyms: Prr4, Pvrl4, 1200017F15Rik, nectin 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71740
Homologene: 32744
Tmed9
Name: transmembrane p24 trafficking protein 9
Synonyms: 2400003B06Rik, p24alpha2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67511
VEGA: 13
Homologene: 68707
Trem2
Name: triggering receptor expressed on myeloid cells 2
Synonyms: Trem2a, Trem2b, Trem2c
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83433
Homologene: 10352
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 20,200,925 bp
  • A to G, chromosome 1 at 23,762,864 bp
  • G to A, chromosome 1 at 40,123,211 bp
  • G to A, chromosome 1 at 52,082,552 bp
  • A to G, chromosome 1 at 58,179,335 bp
  • G to A, chromosome 1 at 89,968,484 bp
  • G to T, chromosome 1 at 91,494,757 bp
  • A to G, chromosome 1 at 106,949,671 bp
  • A to T, chromosome 1 at 150,104,507 bp
  • A to G, chromosome 1 at 150,419,895 bp
  • A to T, chromosome 1 at 155,129,308 bp
  • A to T, chromosome 1 at 157,558,060 bp
  • G to A, chromosome 1 at 171,383,758 bp
  • A to C, chromosome 1 at 173,332,212 bp
  • C to T, chromosome 2 at 13,360,365 bp
  • T to C, chromosome 2 at 23,187,844 bp
  • A to G, chromosome 2 at 85,753,492 bp
  • A to T, chromosome 2 at 91,383,773 bp
  • C to A, chromosome 2 at 129,460,447 bp
  • G to A, chromosome 2 at 179,932,029 bp
  • G to A, chromosome 3 at 33,809,441 bp
  • A to G, chromosome 3 at 51,257,614 bp
  • A to T, chromosome 3 at 68,697,902 bp
  • A to T, chromosome 3 at 104,494,669 bp
  • G to A, chromosome 3 at 151,492,309 bp
  • C to T, chromosome 3 at 154,763,789 bp
  • T to A, chromosome 4 at 86,828,942 bp
  • T to C, chromosome 4 at 88,629,119 bp
  • T to C, chromosome 4 at 144,109,217 bp
  • T to A, chromosome 4 at 150,143,134 bp
  • T to C, chromosome 4 at 151,148,406 bp
  • T to C, chromosome 4 at 154,328,299 bp
  • C to T, chromosome 4 at 156,176,429 bp
  • T to C, chromosome 5 at 33,133,417 bp
  • G to A, chromosome 5 at 77,351,287 bp
  • T to C, chromosome 5 at 110,809,212 bp
  • T to C, chromosome 5 at 137,365,675 bp
  • A to C, chromosome 5 at 145,220,866 bp
  • A to G, chromosome 6 at 58,435,412 bp
  • A to C, chromosome 6 at 72,359,045 bp
  • A to T, chromosome 6 at 141,834,687 bp
  • T to C, chromosome 6 at 149,017,106 bp
  • A to G, chromosome 6 at 149,325,438 bp
  • T to A, chromosome 7 at 3,895,604 bp
  • C to T, chromosome 7 at 12,176,835 bp
  • T to C, chromosome 7 at 24,899,667 bp
  • A to T, chromosome 7 at 120,365,821 bp
  • A to G, chromosome 7 at 139,089,540 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • A to T, chromosome 8 at 13,568,708 bp
  • A to G, chromosome 8 at 95,538,201 bp
  • T to A, chromosome 8 at 105,452,035 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 8 at 110,880,968 bp
  • C to A, chromosome 8 at 119,869,658 bp
  • T to A, chromosome 9 at 48,743,469 bp
  • A to T, chromosome 9 at 86,507,730 bp
  • G to A, chromosome 9 at 121,964,821 bp
  • T to A, chromosome 10 at 13,527,806 bp
  • A to C, chromosome 10 at 18,169,405 bp
  • C to A, chromosome 10 at 31,517,419 bp
  • A to G, chromosome 11 at 22,973,595 bp
  • A to T, chromosome 11 at 49,970,293 bp
  • A to T, chromosome 11 at 73,453,546 bp
  • A to G, chromosome 11 at 77,049,271 bp
  • A to T, chromosome 11 at 90,387,995 bp
  • T to A, chromosome 11 at 94,565,173 bp
  • A to G, chromosome 11 at 104,424,064 bp
  • A to T, chromosome 11 at 107,479,613 bp
  • A to G, chromosome 11 at 115,253,870 bp
  • T to C, chromosome 11 at 116,677,584 bp
  • A to T, chromosome 12 at 31,487,580 bp
  • G to T, chromosome 12 at 86,883,715 bp
  • T to A, chromosome 12 at 111,992,548 bp
  • G to A, chromosome 13 at 49,078,017 bp
  • G to A, chromosome 13 at 55,593,241 bp
  • A to T, chromosome 14 at 79,770,703 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 15 at 66,449,563 bp
  • T to G, chromosome 15 at 78,341,639 bp
  • C to A, chromosome 15 at 102,109,728 bp
  • T to A, chromosome 16 at 35,102,064 bp
  • A to T, chromosome 17 at 47,016,874 bp
  • G to T, chromosome 17 at 48,346,539 bp
  • A to G, chromosome 17 at 52,961,843 bp
  • C to T, chromosome 17 at 87,640,476 bp
  • T to A, chromosome 19 at 4,103,470 bp
  • A to G, chromosome 19 at 59,344,776 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7751 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045807-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.