Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7756Btlr/Mmmh
Stock Number:
045812-MU
Citation ID:
RRID:MMRRC_045812-MU
Other Names:
R7756 (G1)
Major Collection:

Strain Information

Yes1
Name: YES proto-oncogene 1, Src family tyrosine kinase
Synonyms: Yes
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22612
Homologene: 55900
Lin7c
Name: lin-7 homolog C, crumbs cell polarity complex component
Synonyms: LIN-7-C, LIN-7C, Lin7c, MALS-3, Veli3, D2Ertd520e, 9130007B12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22343
Homologene: 22649
Cdyl
Name: chromodomain protein, Y chromosome-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12593
VEGA: 13
HGNC: HGNC:1811
Homologene: 3548
Clcn6
Name: chloride channel, voltage-sensitive 6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26372
HGNC: HGNC:2024
Homologene: 985
Brd4
Name: bromodomain containing 4
Synonyms: MCAP, HUNK1, WI-11513
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57261
Homologene: 136213
Suds3
Name: suppressor of defective silencing 3 homolog (S. cerevisiae)
Synonyms: 2400003N08Rik, 2410008L21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71954
Homologene: 15906
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Pon1
Name: paraoxonase 1
Synonyms: Pon
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18979
HGNC: HGNC:9204
Homologene: 68058
Malt1
Name: MALT1 paracaspase
Synonyms: D430033E09Rik, paracaspase, Pcasp1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240354
HGNC: HGNC:6819
Homologene: 4938
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Slc20a2
Name: solute carrier family 20, member 2
Synonyms: MolPit2, PiT-2, Ram-1, Ram1, Pit-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20516
Homologene: 68531
Ift81
Name: intraflagellar transport 81
Synonyms: CDV-1R, Cdv1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12589
Homologene: 7664
Pdlim1
Name: PDZ and LIM domain 1 (elfin)
Synonyms: mClim1, CLP36
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 54132
HGNC: HGNC:2067
Homologene: 9643
Bpnt2
Name: 3'(2'), 5'-bisphosphate nucleotidase 2
Synonyms: 1110001C20Rik, Jaws, gPAPP, Impad1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242291
Homologene: 9852
Inava
Name: innate immunity activator
Synonyms: 5730559C18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67313
Homologene: 10103
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Irbp, Rbp-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Fcer1a
Name: Fc receptor, IgE, high affinity I, alpha polypeptide
Synonyms: Fce1a, Fcr-5, FcERI
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14125
HGNC: HGNC:3609
Homologene: 1516
Usp40
Name: ubiquitin specific peptidase 40
Synonyms: B230215L03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227334
Homologene: 32400
Strc
Name: stereocilin
Synonyms: DFNB16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140476
Homologene: 15401
Nr1h5
Name: nuclear receptor subfamily 1, group H, member 5
Synonyms: FXRB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381463
Homologene: 131277
Pls1
Name: plastin 1 (I-isoform)
Synonyms: I-fimbrin
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102502
HGNC: HGNC:9090
Homologene: 68270
Dennd5a
Name: DENN domain containing 5A
Synonyms: ORF37, 1500012B19Rik, Rab6ip1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19347
Homologene: 14584
Morc2b
Name: microrchidia 2B
Synonyms: 4932411A10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240069
Homologene: 18615
Ankrd60
Name: ankyrin repeat domain 60
Synonyms: 1700019A24Rik, 1700030G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70065
Homologene: 43792
Megf8
Name: multiple EGF-like-domains 8
Synonyms: Egfl4, b2b288Clo, b2b1702Clo, m687Ddg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269878
HGNC: HGNC:3233
Homologene: 15988
Plekhh1
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms: D630024D12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211945
VEGA: 12
Homologene: 121939
Zbtb4
Name: zinc finger and BTB domain containing 4
Synonyms: 2310026P19Rik, 9230111I22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75580
Homologene: 10846
Gys1
Name: glycogen synthase 1, muscle
Synonyms: Gys3, MGS
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14936
HGNC: HGNC:4706
Homologene: 113557
Stat2
Name: signal transducer and activator of transcription 2
Synonyms: 1600010G07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20847
VEGA: 10
Homologene: 3952
Shcbp1
Name: Shc SH2-domain binding protein 1
Synonyms: mPAL
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20419
Homologene: 32123
Itga1
Name: integrin alpha 1
Synonyms: CD49A, Vla1, E130012M19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109700
VEGA: 13
HGNC: HGNC:6134
Homologene: 57137
Pnma8a
Name: PNMA family member 8A
Synonyms: 0710005I19Rik, 4930488B01Rik, Pnmal1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71691
Homologene: 10073
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: EG381742, Zfp469
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231861
Homologene: 45603
Btbd2
Name: BTB domain containing 2
Synonyms: 2610037C03Rik, 4930512K17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208198
Homologene: 32365
Or2a20
Name: olfactory receptor family 2 subfamily A member 2
Synonyms: GA_x6K02T2P3E9-4341246-4340281, MOR261-10, Olfr434
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258366
Homologene: 133700
Hoxa9
Name: homeobox A9
Synonyms: D6a9, Hox-1.7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15405
HGNC: HGNC:5109
Homologene: 7766
Or8g2
Name: olfactory receptor family 8 subfamily G member 2
Synonyms: GA_x6K02T02EEW-227-373, GA_x6K02T2PVTD-33608180-33608971, MOR171-14, Olfr973, Olfr229
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258606
VEGA: 9
Homologene: 115513
Fstl4
Name: follistatin-like 4
Synonyms: B230374F23Rik, SPIG1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320027
Homologene: 18543
Slc7a11
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 11
Synonyms: System xc, xc, xCT, sut, 9930009M05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26570
Homologene: 22684
Tspan32
Name: tetraspanin 32
Synonyms: D7Wsu37e, Tssc6, Art-1, Tspan32, Phemx
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27027
Homologene: 10650
Disp1
Name: dispatched RND transporter family member 1
Synonyms: DispA, 1190008H24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Or10d4
Name: olfactory receptor family 10 subfamily D member 4
Synonyms: GA_x6K02T2PVTD-33365879-33366814, MOR224-7P, MOR224-13, Olfr963
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258087
VEGA: 9
Homologene: 105216
Vmn1r220
Name: vomeronasal 1 receptor 220
Synonyms: V1rh12
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171271
Homologene: 110880
Snrpa
Name: small nuclear ribonucleoprotein polypeptide A
Synonyms: U1A, U1 snRNP, Rnu1a1, C430021M15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53607
Homologene: 133537
Gm5460
Name: predicted gene 5460
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432838
VEGA: 14
Zfp994
Name: zinc finger protein 994
Synonyms: Gm4944
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240038
VEGA: 17
Homologene: 133246
Cfap99
Name: cilia and flagella associated protein 99
Synonyms: Gm21446
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862066
Homologene: 82544
Gm21886
Name: predicted gene, 21886
Type: Gene
Species: Mouse
Chromosome: 18
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 87,967,200 bp
  • A to G, chromosome 1 at 136,216,433 bp
  • A to G, chromosome 1 at 173,221,575 bp
  • A to C, chromosome 1 at 183,089,734 bp
  • T to A, chromosome 2 at 109,896,372 bp
  • T to C, chromosome 2 at 121,370,946 bp
  • T to C, chromosome 2 at 173,568,769 bp
  • A to G, chromosome 3 at 50,372,360 bp
  • T to C, chromosome 3 at 102,949,609 bp
  • A to T, chromosome 4 at 4,769,385 bp
  • CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC to CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC, chromosome 4 at 43,177,312 bp
  • T to C, chromosome 4 at 148,029,439 bp
  • C to T, chromosome 5 at 32,684,680 bp
  • G to T, chromosome 5 at 34,302,608 bp
  • T to G, chromosome 5 at 117,115,737 bp
  • A to T, chromosome 5 at 122,551,025 bp
  • A to G, chromosome 5 at 142,787,152 bp
  • A to T, chromosome 6 at 5,168,344 bp
  • T to A, chromosome 6 at 43,217,016 bp
  • A to T, chromosome 6 at 52,225,562 bp
  • A to T, chromosome 7 at 16,961,299 bp
  • T to C, chromosome 7 at 25,342,425 bp
  • A to G, chromosome 7 at 27,192,946 bp
  • T to C, chromosome 7 at 45,448,302 bp
  • T to C, chromosome 7 at 109,921,507 bp
  • A to G, chromosome 7 at 143,017,222 bp
  • T to C, chromosome 8 at 4,744,545 bp
  • T to G, chromosome 8 at 22,535,492 bp
  • T to C, chromosome 9 at 39,669,075 bp
  • T to G, chromosome 9 at 39,910,325 bp
  • T to C, chromosome 9 at 95,776,844 bp
  • T to C, chromosome 10 at 80,648,606 bp
  • CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC to CGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCAGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCTGCTGGAGCCAGCCCCACAAGTCCTGCTGGAGCTAGCCCCACAAGTCCAGCTGGAGCCAGC, chromosome 10 at 128,290,728 bp
  • C to A, chromosome 11 at 53,168,296 bp
  • A to G, chromosome 11 at 69,778,542 bp
  • C to T, chromosome 12 at 40,710,879 bp
  • T to C, chromosome 12 at 79,070,804 bp
  • G to A, chromosome 13 at 23,183,707 bp
  • T to A, chromosome 13 at 35,872,641 bp
  • T to A, chromosome 13 at 114,992,460 bp
  • G to A, chromosome 14 at 33,954,775 bp
  • A to T, chromosome 14 at 34,035,157 bp
  • G to A, chromosome 15 at 5,099,896 bp
  • T to C, chromosome 17 at 22,200,847 bp
  • A to G, chromosome 17 at 32,198,982 bp
  • A to G, chromosome 17 at 33,137,007 bp
  • A to G, chromosome 18 at 65,473,119 bp
  • A to C, chromosome 18 at 67,856,313 bp
  • ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG to ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG, chromosome 18 at 80,089,825 bp
  • G to A, chromosome 19 at 40,243,542 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7756 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045812-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.