Strain Name:
C57BL/6J-MtgxR7757Btlr/Mmmh
Stock Number:
045813-MU
Citation ID:
RRID:MMRRC_045813-MU
Other Names:
R7757 (G1)
Major Collection:

Strain Information

Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Gpr37
Name: G protein-coupled receptor 37
Synonyms: Pael-R, parkin-associated endothelin B-like receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14763
HGNC: HGNC:4494
Homologene: 3875
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Gprc5a
Name: G protein-coupled receptor, family C, group 5, member A
Synonyms: Gprc5a, Raig1, Rai3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232431
HGNC: HGNC:9836
Homologene: 2961
Jak2
Name: Janus kinase 2
Synonyms: C81284
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16452
VEGA: 19
HGNC: HGNC:6192
Homologene: 21033
Nup62
Name: nucleoporin 62
Synonyms: p62, Nupc1, D7Ertd649e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18226
HGNC: HGNC:8066
Homologene: 68773
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Schip1
Name: schwannomin interacting protein 1
Synonyms: SCHIP-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30953
Homologene: 130673
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Smad2
Name: SMAD family member 2
Synonyms: Madr2, Smad 2, Madh2, 7120426M23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17126
HGNC: HGNC:6768
Homologene: 21197
Ap3b1
Name: adaptor-related protein complex 3, beta 1 subunit
Synonyms: rim2, Hps2, recombination induced mutation 2, beta3A, AP-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11774
VEGA: 13
HGNC: HGNC:566
Homologene: 68125
Septin11
Name: septin 11
Synonyms: 6230410I01Rik, D5Ertd606e, Sept11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52398
Homologene: 56800
Clcn7
Name: chloride channel, voltage-sensitive 7
Synonyms: ClC-7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26373
HGNC: HGNC:2025
Homologene: 56546
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Rnf216
Name: ring finger protein 216
Synonyms: UIP83, F830018F18Rik, 2810055G22Rik, Ubce7ip1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108086
Homologene: 19442
Hk2
Name: hexokinase 2
Synonyms: HKII
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15277
HGNC: HGNC:4923
Homologene: 37273
Agk
Name: acylglycerol kinase
Synonyms: MuLK, 2610037M15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69923
Homologene: 41239
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212377
Homologene: 18874
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Egfr
Name: epidermal growth factor receptor
Synonyms: avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Erbb, Wa5, 9030024J15Rik, Errb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13649
HGNC: HGNC:3236
Homologene: 74545
Slitrk3
Name: SLIT and NTRK-like family, member 3
Synonyms: ST3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 386750
Homologene: 8955
Plxdc2
Name: plexin domain containing 2
Synonyms: 1200007L24Rik, Tem7r, 5430431D22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67448
Homologene: 41666
Ibtk
Name: inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms: 5430411K16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108837
Homologene: 34661
2700049A03Rik
Name: RIKEN cDNA 2700049A03 gene
Synonyms: talpid3, Ta3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76967
Homologene: 8839
Dync1li1
Name: dynein cytoplasmic 1 light intermediate chain 1
Synonyms: LIC-1, 1110053F02Rik, Dnclic1, Dlic1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235661
VEGA: 9
Homologene: 9403
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Ckap4
Name: cytoskeleton-associated protein 4
Synonyms: CLIMP-63, P63, 5630400A09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216197
VEGA: 10
Homologene: 4970
Nlrc4
Name: NLR family, CARD domain containing 4
Synonyms: 9530011P19Rik, Card12, Ipaf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268973
VEGA: 17
Homologene: 10924
Ginm1
Name: glycoprotein integral membrane 1
Synonyms: BC013529
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215751
Homologene: 16347
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: b2b012Clo, Jbts17, Hug, 2410089E03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
Stk31
Name: serine threonine kinase 31
Synonyms: C330007K24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77485
Homologene: 12677
Capn12
Name: calpain 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60594
Homologene: 77333
Il23r
Name: interleukin 23 receptor
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209590
Homologene: 16930
Sos2
Name: SOS Ras/Rho guanine nucleotide exchange factor 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20663
Homologene: 38253
Bche
Name: butyrylcholinesterase
Synonyms: C730038G20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12038
HGNC: HGNC:983
Homologene: 20065
Irs2
Name: insulin receptor substrate 2
Synonyms: Irs-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384783
HGNC: HGNC:6126
Homologene: 2778
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Disp2
Name: dispatched RND transporter family member 2
Synonyms: DispB, B230210L08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214240
Homologene: 24916
Csmd2
Name: CUB and Sushi multiple domains 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329942
Homologene: 89034
Or10d1
Name: olfactory receptor family 10 subfamily D member 1
Synonyms: GA_x6K02T2PVTD-33270211-33269276, MOR224-3, Olfr959
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258501
VEGA: 9
Homologene: 71989
Tll2
Name: tolloid-like 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 24087
VEGA: 19
Homologene: 56545
Cpne9
Name: copine family member IX
Synonyms: A730016F12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211232
Homologene: 84686
Pcdhb14
Name: protocadherin beta 14
Synonyms: Pcdhb17, PcdhbN, 2210006M07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93885
Homologene: 70876
Pex5l
Name: peroxisomal biogenesis factor 5-like
Synonyms: 1700016J08Rik, PXR2, TRIP8b, Pex2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 58869
Homologene: 9562
Gys2
Name: glycogen synthase 2
Synonyms: LGS, glycogen synthase, liver
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232493
HGNC: HGNC:4707
Homologene: 56580
Epb42
Name: erythrocyte membrane protein band 4.2
Synonyms: Epb4.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13828
HGNC: HGNC:3381
Homologene: 93
Disc1
Name: disrupted in schizophrenia 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244667
HGNC: HGNC:2888
Homologene: 10257
Acox2
Name: acyl-Coenzyme A oxidase 2, branched chain
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 93732
HGNC: HGNC:120
Homologene: 74473
Slc36a4
Name: solute carrier family 36 (proton/amino acid symporter), member 4
Synonyms: PAT4, 6330573I15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234967
Homologene: 56300
Sdc2
Name: syndecan 2
Synonyms: fibroglycan, Synd2, Hspg1, 4833414L08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15529
Homologene: 2253
Mill1
Name: MHC I like leukocyte 1
Synonyms: 5530400I18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 266815
HGNC: HGNC:7090
Homologene: 105329
Ska1
Name: spindle and kinetochore associated complex subunit 1
Synonyms: 2810433K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66468
VEGA: 18
Homologene: 11975
Stox1
Name: storkhead box 1
Synonyms: 4732470K04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216021
Homologene: 17649
Snx21
Name: sorting nexin family member 21
Synonyms: 5730407K14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 101113
Homologene: 43132
Vmn2r43
Name: vomeronasal 2, receptor 43
Synonyms: EC2-V2R
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381838
Homologene: 113703
Gm4744
Name: predicted gene 4744
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194360
Nudt16
Name: nudix hydrolase 16
Synonyms: 2810047L04Rik, 2900006H04Rik, 2310041H06Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 16
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75686
Homologene: 12617
6430550D23Rik
Name: RIKEN cDNA 6430550D23 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320095
Homologene: 122133
Or4c117
Name: olfactory receptor family 4 subfamily C member 117
Synonyms: GA_x6K02T2Q125-50604368-50603433, MOR233-14, Olfr1222
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258177
Homologene: 73988
Zscan4f
Name: zinc finger and SCAN domain containing 4F
Synonyms: C330039H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665902
Homologene: 85986
Mup8
Name: major urinary protein 8
Synonyms: Gm12809
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041687
Homologene: 74304
Gm49368
Name: predicted gene, 49368
Type: Gene
Species: Mouse
Chromosome: 7
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 20,562,415 bp
  • A to T, chromosome 1 at 60,257,450 bp
  • A to G, chromosome 2 at 16,729,376 bp
  • T to C, chromosome 2 at 76,918,490 bp
  • T to C, chromosome 2 at 89,124,989 bp
  • T to C, chromosome 2 at 118,790,910 bp
  • T to C, chromosome 2 at 121,027,719 bp
  • T to C, chromosome 2 at 156,003,431 bp
  • T to C, chromosome 2 at 164,786,165 bp
  • T to C, chromosome 3 at 33,082,151 bp
  • C to A, chromosome 3 at 68,617,695 bp
  • G to A, chromosome 3 at 73,050,839 bp
  • T to A, chromosome 3 at 73,701,121 bp
  • T to C, chromosome 4 at 24,598,884 bp
  • CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC to CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC, chromosome 4 at 43,177,312 bp
  • AGAGCC to AGAGCCCGAGCC, chromosome 4 at 43,177,330 bp
  • CAGAGC to CAGAGCGAGAGC, chromosome 4 at 43,177,341 bp
  • C to A, chromosome 4 at 60,220,332 bp
  • T to A, chromosome 4 at 60,220,333 bp
  • T to A, chromosome 4 at 128,483,456 bp
  • A to T, chromosome 5 at 93,171,464 bp
  • T to A, chromosome 5 at 143,080,236 bp
  • T to A, chromosome 6 at 25,688,208 bp
  • T to C, chromosome 6 at 40,376,278 bp
  • A to G, chromosome 6 at 40,950,433 bp
  • T to G, chromosome 6 at 49,406,943 bp
  • T to G, chromosome 6 at 67,423,981 bp
  • T to C, chromosome 6 at 82,742,915 bp
  • G to A, chromosome 6 at 113,284,445 bp
  • T to A, chromosome 6 at 135,079,344 bp
  • A to T, chromosome 6 at 142,454,451 bp
  • A to T, chromosome 7 at 8,255,254 bp
  • G to T, chromosome 7 at 11,401,278 bp
  • T to C, chromosome 7 at 18,262,466 bp
  • T to C, chromosome 7 at 28,882,821 bp
  • T to C, chromosome 7 at 44,828,995 bp
  • A to T, chromosome 7 at 119,971,215 bp
  • A to G, chromosome 7 at 120,071,570 bp
  • C to T, chromosome 7 at 127,530,794 bp
  • C to T, chromosome 7 at 128,112,226 bp
  • T to A, chromosome 8 at 11,006,522 bp
  • A to G, chromosome 8 at 125,087,504 bp
  • A to G, chromosome 9 at 15,719,660 bp
  • A to G, chromosome 9 at 39,572,465 bp
  • A to C, chromosome 9 at 85,697,237 bp
  • A to C, chromosome 9 at 105,131,561 bp
  • A to G, chromosome 9 at 108,114,740 bp
  • A to G, chromosome 9 at 114,709,277 bp
  • A to T, chromosome 10 at 7,779,355 bp
  • A to T, chromosome 10 at 11,162,180 bp
  • T to C, chromosome 10 at 62,663,964 bp
  • T to C, chromosome 10 at 84,528,467 bp
  • T to A, chromosome 10 at 100,563,434 bp
  • T to A, chromosome 10 at 107,876,921 bp
  • T to C, chromosome 11 at 16,889,966 bp
  • T to A, chromosome 11 at 55,311,421 bp
  • C to A, chromosome 11 at 105,776,858 bp
  • C to T, chromosome 12 at 44,549,898 bp
  • A to G, chromosome 12 at 69,648,585 bp
  • G to A, chromosome 12 at 71,189,413 bp
  • G to T, chromosome 12 at 76,061,779 bp
  • T to A, chromosome 13 at 93,098,272 bp
  • T to A, chromosome 13 at 94,528,158 bp
  • A to G, chromosome 13 at 98,764,503 bp
  • T to C, chromosome 14 at 8,230,166 bp
  • A to T, chromosome 14 at 103,191,619 bp
  • A to T, chromosome 15 at 8,252,227 bp
  • A to T, chromosome 15 at 33,028,087 bp
  • C to T, chromosome 15 at 82,082,623 bp
  • T to C, chromosome 17 at 25,156,822 bp
  • T to A, chromosome 17 at 74,448,196 bp
  • A to T, chromosome 18 at 12,933,600 bp
  • T to A, chromosome 18 at 37,449,834 bp
  • T to A, chromosome 18 at 74,196,973 bp
  • C to T, chromosome 18 at 76,288,013 bp
  • T to C, chromosome 19 at 29,283,546 bp
  • A to T, chromosome 19 at 41,096,008 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7757 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045813-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.