Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7769Btlr/Mmmh
Stock Number:
045825-MU
Citation ID:
RRID:MMRRC_045825-MU
Other Names:
R7769 (G1)
Major Collection:

Strain Information

Fgg
Name: fibrinogen gamma chain
Synonyms: gamma-fibrinogen, 3010002H13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99571
HGNC: HGNC:3694
Homologene: 429
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: Cav3.2, alpha13.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Epb41l2
Name: erythrocyte membrane protein band 4.1 like 2
Synonyms: NBL2, 4.1G, D10Ertd398e, Epb4.1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13822
VEGA: 10
HGNC: HGNC:3379
Homologene: 37478
Spred1
Name: sprouty protein with EVH-1 domain 1, related sequence
Synonyms: Spred-1, 5730461F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114715
Homologene: 24919
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Ctnnbl1
Name: catenin, beta like 1
Synonyms: NYD-SP19, FLJ21108, P14L, 5730471K09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66642
Homologene: 12003
Nsf
Name: N-ethylmaleimide sensitive fusion protein
Synonyms: SKD2, N-ethylmaleimide sensitive factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18195
HGNC: HGNC:8016
Homologene: 4502
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Epb41l3
Name: erythrocyte membrane protein band 4.1 like 3
Synonyms: NBL3, 4.1B, DAL1P, Epb4.1l3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13823
HGNC: HGNC:3380
Homologene: 49308
Uvrag
Name: UV radiation resistance associated gene
Synonyms: 9530039D02Rik, Uvragl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78610
Homologene: 31150
Stag1
Name: STAG1 cohesin complex component
Synonyms: SA-1, Scc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20842
Homologene: 21191
Tshr
Name: thyroid stimulating hormone receptor
Synonyms: hyt, pet, hypothroid
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22095
Homologene: 315
Secisbp2l
Name: SECIS binding protein 2-like
Synonyms: 3110001I20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70354
Homologene: 18923
Niban2
Name: niban apoptosis regulator 2
Synonyms: 9130404D14Rik, Fam129b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227737
Homologene: 11269
Stxbp3
Name: syntaxin binding protein 3
Synonyms: Munc-18c, Stxbp3, Stxbp3a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20912
Homologene: 5260
Clpb
Name: ClpB caseinolytic peptidase B
Synonyms: Skd3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20480
Homologene: 32067
Cnr1
Name: cannabinoid receptor 1
Synonyms: CB1, CB1R
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12801
HGNC: HGNC:2159
Homologene: 7273
Pgr
Name: progesterone receptor
Synonyms: PR, NR3C3, 9930019P03Rik, PR-B, PR-A, ENSMUSG00000074510
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18667
HGNC: HGNC:8910
Homologene: 713
Rtn4r
Name: reticulon 4 receptor
Synonyms: Nogo-66 receptor, NgR, NgR1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 65079
Homologene: 11299
Syt14
Name: synaptotagmin XIV
Synonyms: B230320I09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329324
Homologene: 17719
Scamp3
Name: secretory carrier membrane protein 3
Synonyms: Sc3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24045
Homologene: 4164
Zap70
Name: zeta-chain (TCR) associated protein kinase
Synonyms: Srk, TZK, ZAP-70
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22637
Homologene: 839
Lig4
Name: ligase IV, DNA, ATP-dependent
Synonyms: DNA ligase IV, 5830471N16Rik, tiny
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319583
HGNC: HGNC:6601
Homologene: 1736
Ibsp
Name: integrin binding sialoprotein
Synonyms: BSP, bone sialoprotein, Bsp2, Bsp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15891
HGNC: HGNC:5341
Homologene: 3644
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Rbl1
Name: RB transcriptional corepressor like 1
Synonyms: p107, retinoblastoma-like 1 (p107)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19650
HGNC: HGNC:9893
Homologene: 2172
Vkorc1
Name: vitamin K epoxide reductase complex, subunit 1
Synonyms: D7Wsu86e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27973
Homologene: 11416
Smad5
Name: SMAD family member 5
Synonyms: Smad 5, MusMLP, Madh5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17129
HGNC: HGNC:6771
Homologene: 4313
Grk6
Name: G protein-coupled receptor kinase 6
Synonyms: Gprk6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26385
VEGA: 13
HGNC: HGNC:4545
Homologene: 37570
Psmd11
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 11
Synonyms: P44.5, S9, 1810019E17Rik, C78232, 2810055C24Rik, 2610024G20Rik, 1700089D09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69077
HGNC: HGNC:9556
Homologene: 2108
Ccdc88a
Name: coiled coil domain containing 88A
Synonyms: C330012F17Rik, D130005J21Rik, C130096N06Rik, GIV, HkRP1, Girdin, A430106J12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108686
Homologene: 41180
Qser1
Name: glutamine and serine rich 1
Synonyms: 4732486I23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99003
Homologene: 11710
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Hps3
Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms: Hermansky-Pudlak syndrome 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12807
Homologene: 13019
Mttp
Name: microsomal triglyceride transfer protein
Synonyms: MTP, 1810043K16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17777
HGNC: HGNC:7467
Homologene: 212
Or1p1
Name: olfactory receptor family 1 subfamily P member 1
Synonyms: IH3, MOR133-3P, GA_x6K02T2P1NL-4434429-4435400, Olfr59
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18359
HGNC: HGNC:8222
Homologene: 73924
Cd244a
Name: CD244 molecule A
Synonyms: 2B4, C9.1, Nmrk, F730046O15Rik, Cd244
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18106
Homologene: 9493
Zc3h12d
Name: zinc finger CCCH type containing 12D
Synonyms: D730019B10Rik, TFL
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237256
VEGA: 10
Homologene: 18225
Hspb7
Name: heat shock protein family, member 7 (cardiovascular)
Synonyms: cvHsp, Hsp25-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29818
HGNC: HGNC:5249
Homologene: 8480
Klhl42
Name: kelch-like 42
Synonyms: C230080I20Rik, Klhdc5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232539
Homologene: 45842
Arhgef38
Name: Rho guanine nucleotide exchange factor 38
Synonyms: 9130221D24Rik, D630013G24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77669
Homologene: 137396
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Tns1
Name: tensin 1
Synonyms: 1200014E20Rik, E030018G17Rik, 1110018I21Rik, Tns, E030037J05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21961
Homologene: 11219
Shcbp1
Name: Shc SH2-domain binding protein 1
Synonyms: mPAL
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20419
Homologene: 32123
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
Wdsub1
Name: WD repeat, SAM and U-box domain containing 1
Synonyms: 1700048E19Rik, 2610014F08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72137
Homologene: 17609
Vmn1r63
Name: vomeronasal 1 receptor 63
Synonyms: V1R1, V1rd1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81017
Homologene: 41799
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Adam26b
Name: a disintegrin and metallopeptidase domain 26B
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382007
Homologene: 128363
Rasip1
Name: Ras interacting protein 1
Synonyms: 2610025P08Rik, Rain
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69903
Homologene: 9847
Zfp438
Name: zinc finger protein 438
Synonyms: 9430091M14Rik, B830013J05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240186
VEGA: 18
Homologene: 18695
Krt12
Name: keratin 12
Synonyms: K12, Krt1-12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268482
HGNC: HGNC:6414
Homologene: 188
Pyroxd2
Name: pyridine nucleotide-disulphide oxidoreductase domain 2
Synonyms: 3830409H07Rik, 4833409A17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74580
VEGA: 19
Homologene: 13097
Iqca1
Name: IQ motif containing with AAA domain 1
Synonyms: 4930585L22Rik, 4930465P12Rik, Iqca
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74918
Homologene: 49784
Pknox2
Name: Pbx/knotted 1 homeobox 2
Synonyms: Prep2, D230005H23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208076
Homologene: 32527
Akr1c14
Name: aldo-keto reductase family 1, member C14
Synonyms: 9030611N15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105387
Homologene: 138093
Cabp5
Name: calcium binding protein 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29865
Homologene: 8486
P4ha3
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III
Synonyms: D930031A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320452
Homologene: 27943
Slc5a10
Name: solute carrier family 5 (sodium/glucose cotransporter), member 10
Synonyms: SGLT5, C330021F16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 109342
Homologene: 65037
Abhd14b
Name: abhydrolase domain containing 14b
Synonyms: 1810013B01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76491
Homologene: 9125
Gprin2
Name: G protein regulated inducer of neurite outgrowth 2
Synonyms: C130040D06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432839
VEGA: 14
Homologene: 40975
Thpo
Name: thrombopoietin
Synonyms: TPO-4, TPO-3, TPO-2, TPO-1, TPO, Mpllg, myeloproliferative leukemia virus oncogene ligand
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21832
Homologene: 398
Pcmtd2
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
Synonyms: 5330414D10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245867
Homologene: 10099
Ppp2r3d
Name: protein phosphatase 2 (formerly 2A), regulatory subunit B'', delta
Synonyms: PR59, Ppp2r3, Ppp2r3a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19054
Gm6685
Name: predicted pseudogene 6685
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 626571
VEGA: 11
Trbv26
Name: T cell receptor beta, variable 26
Synonyms: Gm16909, Tcrb-V3.1, Tcrb-V3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110315
Gm37240
Name: predicted gene, 37240
Type: Gene
Species: Mouse
Chromosome: 3
Gm44511
Name: predicted gene 44511
Type: Gene
Species: Mouse
Chromosome: 6
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 36,770,902 bp
  • T to A, chromosome 1 at 73,953,371 bp
  • T to G, chromosome 1 at 90,077,810 bp
  • A to T, chromosome 1 at 135,982,405 bp
  • A to T, chromosome 1 at 171,577,305 bp
  • A to G, chromosome 1 at 192,984,324 bp
  • A to G, chromosome 2 at 32,919,832 bp
  • A to G, chromosome 2 at 59,878,419 bp
  • A to T, chromosome 2 at 104,758,576 bp
  • T to C, chromosome 2 at 117,177,449 bp
  • CTGGG to C, chromosome 2 at 125,771,545 bp
  • T to C, chromosome 2 at 157,191,980 bp
  • C to T, chromosome 2 at 157,737,470 bp
  • T to C, chromosome 2 at 181,851,701 bp
  • T to C, chromosome 3 at 20,018,808 bp
  • A to G, chromosome 3 at 83,013,126 bp
  • A to T, chromosome 3 at 84,509,925 bp
  • A to G, chromosome 3 at 89,177,991 bp
  • A to G, chromosome 3 at 108,800,828 bp
  • A to C, chromosome 3 at 133,149,622 bp
  • A to C, chromosome 3 at 138,103,112 bp
  • A to T, chromosome 4 at 33,944,892 bp
  • T to C, chromosome 4 at 141,424,024 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • A to G, chromosome 5 at 63,804,504 bp
  • A to G, chromosome 5 at 104,306,005 bp
  • A to G, chromosome 5 at 104,310,184 bp
  • A to G, chromosome 6 at 41,227,547 bp
  • T to A, chromosome 6 at 128,820,277 bp
  • T to C, chromosome 6 at 147,091,860 bp
  • C to T, chromosome 7 at 5,803,370 bp
  • A to G, chromosome 7 at 13,400,733 bp
  • C to T, chromosome 7 at 29,098,785 bp
  • A to G, chromosome 7 at 45,628,815 bp
  • G to A, chromosome 7 at 98,979,721 bp
  • A to G, chromosome 7 at 100,285,717 bp
  • G to T, chromosome 7 at 101,722,717 bp
  • T to A, chromosome 7 at 101,999,000 bp
  • G to T, chromosome 7 at 122,128,415 bp
  • G to T, chromosome 7 at 127,894,524 bp
  • A to G, chromosome 8 at 4,739,232 bp
  • A to T, chromosome 8 at 9,973,629 bp
  • C to A, chromosome 8 at 43,521,695 bp
  • A to T, chromosome 8 at 124,564,550 bp
  • C to T, chromosome 9 at 8,946,855 bp
  • T to A, chromosome 9 at 18,660,507 bp
  • C to A, chromosome 9 at 36,895,306 bp
  • T to A, chromosome 9 at 100,944,827 bp
  • T to C, chromosome 9 at 106,451,620 bp
  • T to C, chromosome 9 at 124,439,087 bp
  • G to A, chromosome 10 at 7,867,626 bp
  • A to T, chromosome 10 at 25,493,573 bp
  • T to A, chromosome 11 at 28,339,252 bp
  • A to T, chromosome 11 at 29,482,381 bp
  • T to C, chromosome 11 at 60,509,149 bp
  • T to A, chromosome 11 at 61,673,647 bp
  • T to A, chromosome 11 at 74,288,763 bp
  • T to A, chromosome 11 at 80,434,582 bp
  • C to T, chromosome 11 at 86,719,493 bp
  • C to T, chromosome 11 at 99,418,026 bp
  • C to T, chromosome 11 at 103,928,839 bp
  • T to C, chromosome 12 at 70,043,230 bp
  • A to G, chromosome 12 at 91,538,270 bp
  • T to C, chromosome 13 at 4,059,644 bp
  • A to G, chromosome 13 at 55,451,007 bp
  • T to C, chromosome 13 at 56,733,042 bp
  • A to T, chromosome 14 at 34,195,613 bp
  • ACCAGCCC to ACC, chromosome 14 at 118,615,270 bp
  • C to T, chromosome 16 at 18,151,289 bp
  • C to T, chromosome 16 at 20,725,651 bp
  • T to A, chromosome 17 at 25,385,805 bp
  • T to C, chromosome 17 at 69,238,426 bp
  • C to T, chromosome 18 at 5,213,377 bp
  • T to C, chromosome 19 at 42,747,562 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7769 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045825-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.