Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7769Btlr/Mmmh
Stock Number:
045825-MU
Citation ID:
RRID:MMRRC_045825-MU
Other Names:
R7769 (G1)
Major Collection:

Strain Information

Fgg
Name: fibrinogen gamma chain
Synonyms: gamma-fibrinogen, 3010002H13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99571
HGNC: HGNC:3694
Homologene: 429
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Agt
Name: angiotensinogen
Synonyms: Aogen, Serpina8, angiotensin precursor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Epb41l2
Name: erythrocyte membrane protein band 4.1 like 2
Synonyms: NBL2, 4.1G, D10Ertd398e, Epb4.1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13822
VEGA: 10
HGNC: HGNC:3379
Homologene: 37478
Spred1
Name: sprouty protein with EVH-1 domain 1, related sequence
Synonyms: Spred-1, 5730461F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114715
Homologene: 24919
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 36,770,902 bp
  • T to A, chromosome 1 at 73,953,371 bp
  • T to G, chromosome 1 at 90,077,810 bp
  • A to T, chromosome 1 at 135,982,405 bp
  • A to T, chromosome 1 at 171,577,305 bp
  • A to G, chromosome 1 at 192,984,324 bp
  • A to G, chromosome 2 at 32,919,832 bp
  • A to G, chromosome 2 at 59,878,419 bp
  • A to T, chromosome 2 at 104,758,576 bp
  • T to C, chromosome 2 at 117,177,449 bp
  • CTGGG to C, chromosome 2 at 125,771,545 bp
  • T to C, chromosome 2 at 157,191,980 bp
  • C to T, chromosome 2 at 157,737,470 bp
  • T to C, chromosome 2 at 181,851,701 bp
  • T to C, chromosome 3 at 20,018,808 bp
  • A to G, chromosome 3 at 83,013,126 bp
  • A to T, chromosome 3 at 84,509,925 bp
  • A to G, chromosome 3 at 89,177,991 bp
  • A to G, chromosome 3 at 108,800,828 bp
  • A to C, chromosome 3 at 133,149,622 bp
  • A to C, chromosome 3 at 138,103,112 bp
  • A to T, chromosome 4 at 33,944,892 bp
  • T to C, chromosome 4 at 141,424,024 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • A to G, chromosome 5 at 63,804,504 bp
  • A to G, chromosome 5 at 104,306,005 bp
  • A to G, chromosome 5 at 104,310,184 bp
  • A to G, chromosome 6 at 41,227,547 bp
  • T to A, chromosome 6 at 128,820,277 bp
  • T to C, chromosome 6 at 147,091,860 bp
  • C to T, chromosome 7 at 5,803,370 bp
  • A to G, chromosome 7 at 13,400,733 bp
  • C to T, chromosome 7 at 29,098,785 bp
  • A to G, chromosome 7 at 45,628,815 bp
  • G to A, chromosome 7 at 98,979,721 bp
  • A to G, chromosome 7 at 100,285,717 bp
  • G to T, chromosome 7 at 101,722,717 bp
  • T to A, chromosome 7 at 101,999,000 bp
  • G to T, chromosome 7 at 122,128,415 bp
  • G to T, chromosome 7 at 127,894,524 bp
  • A to G, chromosome 8 at 4,739,232 bp
  • A to T, chromosome 8 at 9,973,629 bp
  • C to A, chromosome 8 at 43,521,695 bp
  • A to T, chromosome 8 at 124,564,550 bp
  • C to T, chromosome 9 at 8,946,855 bp
  • T to A, chromosome 9 at 18,660,507 bp
  • C to A, chromosome 9 at 36,895,306 bp
  • T to A, chromosome 9 at 100,944,827 bp
  • T to C, chromosome 9 at 106,451,620 bp
  • T to C, chromosome 9 at 124,439,087 bp
  • G to A, chromosome 10 at 7,867,626 bp
  • A to T, chromosome 10 at 25,493,573 bp
  • T to A, chromosome 11 at 28,339,252 bp
  • A to T, chromosome 11 at 29,482,381 bp
  • T to C, chromosome 11 at 60,509,149 bp
  • T to A, chromosome 11 at 61,673,647 bp
  • T to A, chromosome 11 at 74,288,763 bp
  • T to A, chromosome 11 at 80,434,582 bp
  • C to T, chromosome 11 at 86,719,493 bp
  • C to T, chromosome 11 at 99,418,026 bp
  • C to T, chromosome 11 at 103,928,839 bp
  • T to C, chromosome 12 at 70,043,230 bp
  • A to G, chromosome 12 at 91,538,270 bp
  • T to C, chromosome 13 at 4,059,644 bp
  • A to G, chromosome 13 at 55,451,007 bp
  • T to C, chromosome 13 at 56,733,042 bp
  • A to T, chromosome 14 at 34,195,613 bp
  • ACCAGCCC to ACC, chromosome 14 at 118,615,270 bp
  • C to T, chromosome 16 at 18,151,289 bp
  • C to T, chromosome 16 at 20,725,651 bp
  • T to A, chromosome 17 at 25,385,805 bp
  • T to C, chromosome 17 at 69,238,426 bp
  • C to T, chromosome 18 at 5,213,377 bp
  • T to C, chromosome 19 at 42,747,562 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7769 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045825-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.