Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7785Btlr/Mmmh
Stock Number:
045841-MU
Citation ID:
RRID:MMRRC_045841-MU
Other Names:
R7785 (G1)
Major Collection:

Strain Information

Slc35a1
Name: solute carrier family 35 (CMP-sialic acid transporter), member 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24060
Homologene: 38181
Iqgap1
Name: IQ motif containing GTPase activating protein 1
Synonyms: D7Ertd237e, D7Ertd257e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29875
HGNC: HGNC:6110
Homologene: 74514
Ppp1r37
Name: protein phosphatase 1, regulatory subunit 37
Synonyms: Lrrc68
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232947
Homologene: 17851
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Erp44
Name: endoplasmic reticulum protein 44
Synonyms: 1110001E24Rik, Txndc4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76299
Homologene: 12638
Gstcd
Name: glutathione S-transferase, C-terminal domain containing
Synonyms: 4933434L15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67553
Homologene: 11693
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 63,147,399 bp
  • T to A, chromosome 1 at 85,620,098 bp
  • C to T, chromosome 2 at 3,424,236 bp
  • T to C, chromosome 2 at 14,420,218 bp
  • A to T, chromosome 2 at 160,910,774 bp
  • A to T, chromosome 2 at 160,970,175 bp
  • A to G, chromosome 3 at 34,046,254 bp
  • C to T, chromosome 3 at 133,082,107 bp
  • A to G, chromosome 4 at 34,675,148 bp
  • TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG, chromosome 4 at 42,871,823 bp
  • G to A, chromosome 4 at 48,243,531 bp
  • T to C, chromosome 5 at 87,843,272 bp
  • T to C, chromosome 5 at 90,550,173 bp
  • A to G, chromosome 5 at 137,429,143 bp
  • T to C, chromosome 5 at 144,174,753 bp
  • A to G, chromosome 6 at 27,618,637 bp
  • A to T, chromosome 6 at 131,245,290 bp
  • G to T, chromosome 6 at 134,432,260 bp
  • A to T, chromosome 7 at 19,532,071 bp
  • T to A, chromosome 7 at 41,613,193 bp
  • A to G, chromosome 7 at 80,738,169 bp
  • T to C, chromosome 7 at 105,567,423 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to G, chromosome 7 at 143,845,472 bp
  • T to C, chromosome 9 at 20,922,049 bp
  • G to A, chromosome 9 at 48,592,009 bp
  • T to C, chromosome 9 at 119,816,556 bp
  • T to A, chromosome 10 at 25,220,661 bp
  • T to C, chromosome 10 at 52,162,848 bp
  • T to A, chromosome 11 at 17,229,785 bp
  • C to A, chromosome 11 at 73,277,732 bp
  • T to C, chromosome 11 at 110,074,206 bp
  • A to G, chromosome 13 at 46,635,748 bp
  • A to T, chromosome 14 at 57,275,481 bp
  • A to G, chromosome 14 at 115,417,220 bp
  • T to C, chromosome 15 at 44,543,569 bp
  • C to A, chromosome 15 at 76,205,829 bp
  • A to G, chromosome 16 at 37,027,877 bp
  • T to C, chromosome 16 at 85,863,004 bp
  • T to A, chromosome 17 at 34,361,163 bp
  • A to T, chromosome 18 at 64,556,850 bp
  • A to G, chromosome 19 at 39,851,166 bp
  • A to G, chromosome 19 at 47,104,686 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7785 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045841-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.