Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7785Btlr/Mmmh
Stock Number:
045841-MU
Citation ID:
RRID:MMRRC_045841-MU
Other Names:
R7785 (G1)
Major Collection:

Strain Information

Slc35a1
Name: solute carrier family 35 (CMP-sialic acid transporter), member 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24060
Homologene: 38181
Iqgap1
Name: IQ motif containing GTPase activating protein 1
Synonyms: D7Ertd237e, D7Ertd257e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 29875
HGNC: HGNC:6110
Homologene: 74514
Ppp1r37
Name: protein phosphatase 1, regulatory subunit 37
Synonyms: Lrrc68
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232947
Homologene: 17851
Dnmt1
Name: DNA methyltransferase 1
Synonyms: MTase, Dnmt1o, Cxxc9, MommeD2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13433
VEGA: 9
HGNC: HGNC:2976
Homologene: 124071
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Erp44
Name: endoplasmic reticulum protein 44
Synonyms: 1110001E24Rik, Txndc4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76299
Homologene: 12638
Gstcd
Name: glutathione S-transferase, C-terminal domain containing
Synonyms: 4933434L15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67553
Homologene: 11693
2610021A01Rik
Name: RIKEN cDNA 2610021A01 gene
Type: Gene
Species: Mouse
Chromosome: 7
Fxr1
Name: FMR1 autosomal homolog 1
Synonyms: 1110050J02Rik, Fxr1p, 9530073J07Rik, Fxr1h
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14359
HGNC: HGNC:4023
Homologene: 3573
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231876
Homologene: 8948
Pdcd11
Name: programmed cell death 11
Synonyms: ALG-4, 1110021I22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18572
VEGA: 19
Homologene: 74968
Akap7
Name: A kinase anchor protein 7
Synonyms: Akap18, AKAP15
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432442
HGNC: HGNC:377
Homologene: 49463
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 6330406J24Rik, 5430439G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Dnaaf10
Name: dynein axonemal assembly factor 10
Synonyms: Wdr92
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103784
Homologene: 16321
Ndufs1
Name: NADH:ubiquinone oxidoreductase core subunit S1
Synonyms: 9930026A05Rik, 5830412M15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227197
HGNC: HGNC:7707
Homologene: 3670
Atp8b1
Name: ATPase, class I, type 8B, member 1
Synonyms: FIC1, Ic
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 54670
VEGA: 18
HGNC: HGNC:3706
Homologene: 21151
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Afm
Name: afamin
Synonyms: Alf, alpha albumin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 280662
HGNC: HGNC:316
Homologene: 881
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Cap2
Name: cyclase associated actin cytoskeleton regulatory protein 2
Synonyms: 2810452G09Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67252
Homologene: 101397
Slc39a12
Name: solute carrier family 39 (zinc transporter), member 12
Synonyms: LOC277468
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277468
Homologene: 17654
Klra2
Name: killer cell lectin-like receptor, subfamily A, member 2
Synonyms: Ly49b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16633
Homologene: 133782
Apbb1
Name: amyloid beta precursor protein binding family B member 1
Synonyms: Fe65, Rir
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11785
HGNC: HGNC:581
Homologene: 898
Trpv3
Name: transient receptor potential cation channel, subfamily V, member 3
Synonyms: 1110036I10Rik, VRL3, Nh
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246788
Homologene: 17040
Grm8
Name: glutamate receptor, metabotropic 8
Synonyms: mGluR8, Gprc1h
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14823
HGNC: HGNC:4600
Homologene: 654
Sp140
Name: Sp140 nuclear body protein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 434484
Homologene: 128391
Nnmt
Name: nicotinamide N-methyltransferase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18113
HGNC: HGNC:7861
Homologene: 4496
Scn11a
Name: sodium channel, voltage-gated, type XI, alpha
Synonyms: SNS2, NaN, NaT, NSS2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24046
VEGA: 9
Homologene: 8041
Gpc5
Name: glypican 5
Synonyms: A230034F01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 103978
HGNC: HGNC:4453
Homologene: 3285
Dhcr7
Name: 7-dehydrocholesterol reductase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13360
HGNC: HGNC:2860
Homologene: 1042
Emilin3
Name: elastin microfibril interfacer 3
Synonyms: Emilin5, 1110013O17Rik, EMILIN-T
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 280635
Homologene: 18817
Cryl1
Name: crystallin, lambda 1
Synonyms: 1110025H08Rik, A230106J09Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 68631
VEGA: 14
Homologene: 9322
Adamts5
Name: ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms: ADAM-TS5, 9530092O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Spata31f3
Name: spermatogenesis associated 31 subfamily F member 3
Synonyms: BC049635, Fam205c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277773
Homologene: 77625
Btnl2
Name: butyrophilin-like 2
Synonyms: butyrophylin-like MHC class II associated, BTL-II, NG9, BTLN2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 547431
HGNC: HGNC:1142
Homologene: 10482
Prr27
Name: proline rich 27
Synonyms: 4930432K09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73779
Homologene: 136277
Cyp2c69
Name: cytochrome P450, family 2, subfamily c, polypeptide 69
Synonyms: AI098658
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100043108
VEGA: 19
HGNC: HGNC:2622
Homologene: 74936
Bcl2l14
Name: BCL2 like 14
Synonyms: 4933405K19Rik, 9030625M01Rik, 4930452K23Rik, Bcl-G
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66813
Homologene: 49840
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 63,147,399 bp
  • T to A, chromosome 1 at 85,620,098 bp
  • C to T, chromosome 2 at 3,424,236 bp
  • T to C, chromosome 2 at 14,420,218 bp
  • A to T, chromosome 2 at 160,910,774 bp
  • A to T, chromosome 2 at 160,970,175 bp
  • A to G, chromosome 3 at 34,046,254 bp
  • C to T, chromosome 3 at 133,082,107 bp
  • A to G, chromosome 4 at 34,675,148 bp
  • TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG, chromosome 4 at 42,871,823 bp
  • G to A, chromosome 4 at 48,243,531 bp
  • T to C, chromosome 5 at 87,843,272 bp
  • T to C, chromosome 5 at 90,550,173 bp
  • A to G, chromosome 5 at 137,429,143 bp
  • T to C, chromosome 5 at 144,174,753 bp
  • A to G, chromosome 6 at 27,618,637 bp
  • A to T, chromosome 6 at 131,245,290 bp
  • G to T, chromosome 6 at 134,432,260 bp
  • A to T, chromosome 7 at 19,532,071 bp
  • T to A, chromosome 7 at 41,613,193 bp
  • A to G, chromosome 7 at 80,738,169 bp
  • T to C, chromosome 7 at 105,567,423 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • A to G, chromosome 7 at 143,845,472 bp
  • T to C, chromosome 9 at 20,922,049 bp
  • G to A, chromosome 9 at 48,592,009 bp
  • T to C, chromosome 9 at 119,816,556 bp
  • T to A, chromosome 10 at 25,220,661 bp
  • T to C, chromosome 10 at 52,162,848 bp
  • T to A, chromosome 11 at 17,229,785 bp
  • C to A, chromosome 11 at 73,277,732 bp
  • T to C, chromosome 11 at 110,074,206 bp
  • A to G, chromosome 13 at 46,635,748 bp
  • A to T, chromosome 14 at 57,275,481 bp
  • A to G, chromosome 14 at 115,417,220 bp
  • T to C, chromosome 15 at 44,543,569 bp
  • C to A, chromosome 15 at 76,205,829 bp
  • A to G, chromosome 16 at 37,027,877 bp
  • T to C, chromosome 16 at 85,863,004 bp
  • T to A, chromosome 17 at 34,361,163 bp
  • A to T, chromosome 18 at 64,556,850 bp
  • A to G, chromosome 19 at 39,851,166 bp
  • A to G, chromosome 19 at 47,104,686 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7785 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045841-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.