Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7802Btlr/Mmmh
Stock Number:
045857-MU
Citation ID:
RRID:MMRRC_045857-MU
Other Names:
R7802 (G1)
Major Collection:

Strain Information

Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Epb41l4a
Name: erythrocyte membrane protein band 4.1 like 4a
Synonyms: NBL4, Epb4.1l4a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13824
VEGA: 18
Homologene: 8398
Med13l
Name: mediator complex subunit 13-like
Synonyms: 2210413I17Rik, 6330591G05Rik, Trap240L, 9030618F05Rik, Thrap2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76199
Homologene: 25256
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: CS group B correcting gene, CSB, C130058G22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Pcnt
Name: pericentrin (kendrin)
Synonyms: Pcnt2, m275Asp, m239Asp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Abl1
Name: c-abl oncogene 1, non-receptor tyrosine kinase
Synonyms: c-Abl, E430008G22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11350
HGNC: HGNC:76
Homologene: 3783
Psmc5
Name: protease (prosome, macropain) 26S subunit, ATPase 5
Synonyms: mSUG1, Rpt6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19184
HGNC: HGNC:9552
Homologene: 2098
Stt3b
Name: STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Synonyms: Simp, 1300006C19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68292
VEGA: 9
Homologene: 7387
Cecr2
Name: CECR2, histone acetyl-lysine reader
Synonyms: 2810409N01Rik, 2610101O16Rik, Gtl4, cat eye syndrome chromosome region, candidate 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330409
HGNC: HGNC:1840
Homologene: 64662
Ermard
Name: ER membrane associated RNA degradation
Synonyms: 2410011O22Rik, 2210404J11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381062
Homologene: 19936
Tmt1a
Name: thiol methyltransferase 1A1
Synonyms: 2210414H16Rik, 3300001H21Rik, Mettl7a, Mettl7a1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70152
VEGA: 15
Homologene: 86842
Gna15
Name: guanine nucleotide binding protein, alpha 15
Synonyms: Galpha15, G[a]15
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14676
HGNC: HGNC:4383
Homologene: 1563
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Slamf8
Name: SLAM family member 8
Synonyms: SBBI42, 5830408F06Rik, Blame
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74748
Homologene: 10589
Slc5a2
Name: solute carrier family 5 (sodium/glucose cotransporter), member 2
Synonyms: Sglt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246787
Homologene: 2289
Rundc3a
Name: RUN domain containing 3A
Synonyms: Rpip8, Rap2ip
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 51799
Homologene: 4871
Pierce1
Name: piercer of microtubule wall 1
Synonyms: 1700007K13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69327
Homologene: 35416
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Mapkapk2
Name: MAP kinase-activated protein kinase 2
Synonyms: MAPKAP kinase 2, Rps6kc1, MK2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17164
HGNC: HGNC:6887
Homologene: 56412
Vwf
Name: Von Willebrand factor
Synonyms: B130011O06Rik, 6820430P06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22371
Homologene: 466
Nadsyn1
Name: NAD synthetase 1
Synonyms: 9130012B15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78914
Homologene: 6098
Galnt16
Name: polypeptide N-acetylgalactosaminyltransferase 16
Synonyms: 5730405L21Rik, Galntl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108760
VEGA: 12
Homologene: 18907
Taar6
Name: trace amine-associated receptor 6
Synonyms: LOC215855
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215855
Homologene: 27874
Vmn2r25
Name: vomeronasal 2, receptor 25
Synonyms: EG545874
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 545874
Homologene: 135915
Col6a2
Name: collagen, type VI, alpha 2
Synonyms: Col6a-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12834
HGNC: HGNC:2212
Homologene: 1392
Nostrin
Name: nitric oxide synthase trafficker
Synonyms: mDaIP2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329416
Homologene: 43142
Serpinb6b
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms: ovalbumin, Spi12, NK13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20708
HGNC: HGNC:8950
Homologene: 22633
Pde8b
Name: phosphodiesterase 8B
Synonyms: B230331L10Rik, C030047E14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218461
HGNC: HGNC:8794
Homologene: 2758
Tgm4
Name: transglutaminase 4 (prostate)
Synonyms: experimental autoimmune prostatitis antigen 1, Eapa1, 9530008N10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 331046
Homologene: 20689
Epha1
Name: Eph receptor A1
Synonyms: Esk, 5730453L17Rik, Eph
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13835
HGNC: HGNC:3385
Homologene: 3835
Togaram1
Name: TOG array regulator of axonemal microtubules 1
Synonyms: A430041B07Rik, Fam179b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 328108
VEGA: 12
Homologene: 15025
Parp16
Name: poly (ADP-ribose) polymerase family, member 16
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214424
VEGA: 9
Homologene: 9878
Slco5a1
Name: solute carrier organic anion transporter family, member 5A1
Synonyms: A630033C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240726
Homologene: 57135
Mrap
Name: melanocortin 2 receptor accessory protein
Synonyms: C21ORF61, 1110025G12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77037
HGNC: HGNC:1304
Homologene: 12669
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 12,990,476 bp
  • T to C, chromosome 1 at 131,056,902 bp
  • A to G, chromosome 1 at 172,588,110 bp
  • TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC to TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC, chromosome 2 at 28,466,110 bp
  • A to G, chromosome 2 at 29,147,021 bp
  • T to C, chromosome 2 at 31,760,426 bp
  • T to C, chromosome 2 at 69,189,012 bp
  • G to A, chromosome 2 at 76,937,671 bp
  • T to C, chromosome 5 at 118,728,590 bp
  • C to T, chromosome 6 at 42,361,941 bp
  • T to C, chromosome 6 at 120,743,847 bp
  • A to T, chromosome 6 at 123,851,832 bp
  • T to C, chromosome 6 at 125,666,677 bp
  • A to G, chromosome 7 at 56,164,090 bp
  • G to T, chromosome 7 at 97,661,772 bp
  • A to T, chromosome 7 at 122,110,896 bp
  • A to C, chromosome 7 at 128,271,798 bp
  • T to C, chromosome 7 at 143,806,026 bp
  • A to G, chromosome 8 at 48,236,465 bp
  • A to G, chromosome 9 at 65,229,897 bp
  • G to T, chromosome 9 at 115,276,881 bp
  • A to G, chromosome 9 at 123,051,336 bp
  • T to A, chromosome 10 at 23,985,253 bp
  • A to T, chromosome 10 at 76,375,303 bp
  • A to T, chromosome 10 at 76,603,798 bp
  • T to C, chromosome 10 at 81,514,341 bp
  • A to G, chromosome 11 at 102,400,009 bp
  • T to C, chromosome 11 at 106,261,712 bp
  • T to C, chromosome 11 at 120,274,692 bp
  • T to A, chromosome 12 at 64,966,984 bp
  • T to G, chromosome 12 at 80,581,247 bp
  • C to T, chromosome 13 at 32,971,596 bp
  • T to C, chromosome 13 at 95,100,938 bp
  • C to A, chromosome 14 at 32,517,303 bp
  • A to T, chromosome 15 at 100,305,301 bp
  • C to T, chromosome 16 at 90,749,359 bp
  • A to G, chromosome 17 at 15,061,161 bp
  • A to G, chromosome 18 at 33,828,174 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7802 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045857-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.