Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7803Btlr/Mmmh
Stock Number:
045858-MU
Citation ID:
RRID:MMRRC_045858-MU
Other Names:
R7803 (G1)
Major Collection:

Strain Information

Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Gch1
Name: GTP cyclohydrolase 1
Synonyms: GTPCH, GTP-CH
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14528
VEGA: 14
HGNC: HGNC:4193
Homologene: 132
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Cbx7
Name: chromobox 7
Synonyms: 1600014J01Rik, D15Ertd417e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 52609
HGNC: HGNC:1557
Homologene: 65296
Orc6
Name: origin recognition complex, subunit 6
Synonyms: 6720420I10Rik, Orc6l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56452
Homologene: 8635
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Ddx39a
Name: DEAD box helicase 39a
Synonyms: 2610307C23Rik, BAT1, Ddx39
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68278
Homologene: 68487
Washc3
Name: WASH complex subunit 3
Synonyms: 5730495F03Rik, 2900091E11Rik, Ccdc53
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67282
Homologene: 9364
Zbtb40
Name: zinc finger and BTB domain containing 40
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230848
Homologene: 8912
Kifc1
Name: kinesin family member C1
Synonyms: Tctex-7, Tctex-7A, Tctex7, Tctex7a, kinesin family c-terminal 5A, HSET, KNSL2, Kifc5a, Gm4137, Knsl2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100502766
HGNC: HGNC:6389
Homologene: 83229
Shq1
Name: SHQ1 homolog (S. cerevisiae)
Synonyms: 2810403P18Rik, Grim-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72171
Homologene: 31683
Ddx41
Name: DEAD box helicase 41
Synonyms: 2900024F02Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72935
VEGA: 13
Homologene: 9431
Clstn1
Name: calsyntenin 1
Synonyms: calsyntenin-1, Cst-1, 1810034E21Rik, alcadein alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65945
Homologene: 8814
Sugp2
Name: SURP and G patch domain containing 2
Synonyms: Srsf14, Sfrs14
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234373
Homologene: 8923
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Maml2
Name: mastermind like transcriptional coactivator 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270118
Homologene: 134147
Acta2
Name: actin alpha 2, smooth muscle, aorta
Synonyms: Actvs, a-SMA, 0610041G09Rik, SMalphaA, alphaSMA, SMAalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 11475
VEGA: 19
HGNC: HGNC:130
Homologene: 133938
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Trim30a
Name: tripartite motif-containing 30A
Synonyms: Rpt-1, Rpt1, Trim30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20128
Homologene: 114426
Stx2
Name: syntaxin 2
Synonyms: Epim, G1-536-1, repro34, Syn-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13852
HGNC: HGNC:3403
Homologene: 37559
Impg2
Name: interphotoreceptor matrix proteoglycan 2
Synonyms: PG10.2, IPM200, Spacrcan
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224224
Homologene: 9439
Ada
Name: adenosine deaminase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11486
HGNC: HGNC:186
Homologene: 37249
Nsun7
Name: NOL1/NOP2/Sun domain family, member 7
Synonyms: 4921525L17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70918
Homologene: 11653
Or6c1b
Name: olfactory receptor family 6 subfamily C member 1B
Synonyms: GA_x6K02T2PULF-11116958-11117896, MOR111-5, Olfr786
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258542
HGNC: HGNC:8355
Homologene: 133582
Folh1
Name: folate hydrolase 1
Synonyms: mopsm, prostate-specific membrane antigen, glutamate carboxypeptidase II, GCP2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53320
Homologene: 55826
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Lpin3
Name: lipin 3
Synonyms: 9130206L11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64899
Homologene: 84844
Ces2h
Name: carboxylesterase 2H
Synonyms: Gm5744
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 436059
HGNC: HGNC:1864
Homologene: 128645
Plxnc1
Name: plexin C1
Synonyms: vespr, CD232, 2510048K12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 54712
HGNC: HGNC:9106
Homologene: 4211
Srm
Name: spermidine synthase
Synonyms: SpdSy, SpdST
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20810
Homologene: 40514
Arg1
Name: arginase, liver
Synonyms: PGIF, Arg-1, AI
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11846
VEGA: 10
HGNC: HGNC:663
Homologene: 29
Washc1
Name: WASH complex subunit 1
Synonyms: 1110049F14Rik, ORF19, Wash, Wash1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68767
VEGA: 17
Homologene: 45706
Vmn2r24
Name: vomeronasal 2, receptor 24
Synonyms: EG243628
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243628
Homologene: 135915
Fbln5
Name: fibulin 5
Synonyms: EVEC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23876
VEGA: 12
HGNC: HGNC:3602
Homologene: 38170
Sele
Name: selectin, endothelial cell
Synonyms: E-selectin, CD62E, Elam
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20339
Homologene: 389
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: 1600029H12Rik, Psg30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
Homologene: 115938
Spata31e3
Name: spermatogenesis associated 31 subfamily E member 3
Synonyms: LOC380882, Gm906
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380882
VEGA: 13
Homologene: 134512
Or8g55
Name: olfactory receptor family 8 subfamily G member 55
Synonyms: GA_x6K02T2PVTD-33572803-33573747, MOR171-17, Olfr972
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258603
VEGA: 9
Homologene: 121532
Vmn2r69
Name: vomeronasal 2, receptor 69
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330581
Homologene: 115466
Hecw1
Name: HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
Synonyms: NEDL1, E130207I19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94253
VEGA: 13
Homologene: 9004
Gpr149
Name: G protein-coupled receptor 149
Synonyms: PGR10, 9630018L10Rik, Ieda, R35
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229357
Homologene: 16359
Or6c205
Name: olfactory receptor family 6 subfamily C member 205
Synonyms: GA_x6K02T2PULF-10936819-10937757, MOR111-7, MOR111-6, MOR111-7, Olfr1518, Olfr775
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258538
Homologene: 115559
Tmem38a
Name: transmembrane protein 38A
Synonyms: 1110001E17Rik, TRIC-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74166
Homologene: 11449
Trbv16
Name: T cell receptor beta, variable 16
Synonyms: Gm16776, Tcrb-V11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 100124680
Rtkn2
Name: rhotekin 2
Synonyms: B130039D23Rik, RTKN2, Mbf, Plekhk1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 170799
Homologene: 17065
Csrp3
Name: cysteine and glycine-rich protein 3
Synonyms: CRP3, muscle LIM protein, MLP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13009
HGNC: HGNC:2472
Homologene: 20742
Insl3
Name: insulin-like 3
Synonyms: Ley I-L, Rlf, Rlnl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16336
HGNC: HGNC:6086
Homologene: 4048
Sparc
Name: secreted acidic cysteine rich glycoprotein
Synonyms: osteonectin, BM-40
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20692
Homologene: 31132
Krt33b
Name: keratin 33B
Synonyms: Ha3, Ha4, mHa3, Krt1-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16671
Homologene: 74433
Chst11
Name: carbohydrate sulfotransferase 11
Synonyms: C4ST-1, C4ST1, C4ST, chondroitin 4, 1110020P09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58250
Homologene: 56808
Eif1ad4
Name: eukaryotic translation initiation factor 1A domain containing 4
Synonyms: Gm2022
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100039052
HGNC: HGNC:3252
Homologene: 103865
Tff3
Name: trefoil factor 3, intestinal
Synonyms: mITF, ITF
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21786
Homologene: 2427
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 82,489,698 bp
  • A to T, chromosome 1 at 150,770,279 bp
  • T to C, chromosome 1 at 164,050,694 bp
  • T to G, chromosome 2 at 76,776,371 bp
  • A to G, chromosome 2 at 160,895,390 bp
  • A to G, chromosome 2 at 163,735,368 bp
  • A to G, chromosome 3 at 62,530,715 bp
  • T to A, chromosome 4 at 137,017,327 bp
  • T to C, chromosome 4 at 148,593,945 bp
  • T to C, chromosome 4 at 149,631,871 bp
  • T to A, chromosome 5 at 66,276,541 bp
  • C to A, chromosome 5 at 128,993,563 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • G to A, chromosome 6 at 41,151,995 bp
  • A to G, chromosome 6 at 100,671,045 bp
  • T to A, chromosome 6 at 123,780,479 bp
  • A to G, chromosome 7 at 17,759,392 bp
  • T to G, chromosome 7 at 48,833,797 bp
  • G to T, chromosome 7 at 85,407,116 bp
  • G to A, chromosome 7 at 86,726,098 bp
  • G to A, chromosome 7 at 104,411,397 bp
  • C to T, chromosome 8 at 70,252,072 bp
  • T to C, chromosome 8 at 71,689,340 bp
  • C to T, chromosome 8 at 72,572,120 bp
  • T to C, chromosome 8 at 83,719,600 bp
  • T to A, chromosome 8 at 85,303,408 bp
  • A to G, chromosome 8 at 105,018,400 bp
  • AGC to AGCCGC, chromosome 9 at 13,621,254 bp
  • AGC to AGCCGC, chromosome 9 at 13,621,275 bp
  • GCA to GCACCA, chromosome 9 at 13,621,276 bp
  • A to T, chromosome 9 at 39,874,082 bp
  • C to T, chromosome 10 at 24,916,791 bp
  • G to A, chromosome 10 at 67,979,813 bp
  • A to T, chromosome 10 at 83,191,186 bp
  • G to T, chromosome 10 at 88,216,075 bp
  • A to G, chromosome 10 at 94,943,515 bp
  • A to T, chromosome 10 at 129,250,995 bp
  • A to G, chromosome 10 at 129,436,931 bp
  • A to T, chromosome 11 at 36,047,116 bp
  • A to T, chromosome 11 at 55,409,971 bp
  • A to G, chromosome 11 at 100,025,258 bp
  • T to A, chromosome 12 at 87,895,499 bp
  • A to T, chromosome 12 at 101,761,818 bp
  • G to T, chromosome 13 at 14,234,342 bp
  • A to G, chromosome 13 at 50,246,190 bp
  • A to G, chromosome 13 at 55,531,921 bp
  • T to A, chromosome 14 at 47,188,961 bp
  • G to A, chromosome 15 at 37,979,832 bp
  • A to T, chromosome 15 at 59,368,459 bp
  • G to A, chromosome 15 at 79,933,823 bp
  • A to T, chromosome 15 at 98,862,923 bp
  • A to G, chromosome 16 at 4,304,380 bp
  • G to A, chromosome 16 at 15,806,096 bp
  • T to C, chromosome 16 at 56,267,150 bp
  • T to C, chromosome 17 at 31,129,570 bp
  • T to C, chromosome 17 at 33,884,740 bp
  • T to A, chromosome 17 at 66,119,060 bp
  • C to A, chromosome 19 at 34,243,418 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7803 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045858-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.