Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7803Btlr/Mmmh
Stock Number:
045858-MU
Citation ID:
RRID:MMRRC_045858-MU
Other Names:
R7803 (G1)
Major Collection:

Strain Information

Adcy9
Name: adenylate cyclase 9
Synonyms: D16Wsu65e, ACtp10
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11515
HGNC: HGNC:240
Homologene: 868
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Gch1
Name: GTP cyclohydrolase 1
Synonyms: GTPCH, GTP-CH
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14528
VEGA: 14
HGNC: HGNC:4193
Homologene: 132
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Cbx7
Name: chromobox 7
Synonyms: 1600014J01Rik, D15Ertd417e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 52609
HGNC: HGNC:1557
Homologene: 65296
Orc6
Name: origin recognition complex, subunit 6
Synonyms: 6720420I10Rik, Orc6l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56452
Homologene: 8635
Tenm2
Name: teneurin transmembrane protein 2
Synonyms: Ten-m2, D3Bwg1534e, 9330187F13Rik, 2610040L17Rik, Odz2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 23964
Homologene: 22672
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 82,489,698 bp
  • A to T, chromosome 1 at 150,770,279 bp
  • T to C, chromosome 1 at 164,050,694 bp
  • T to G, chromosome 2 at 76,776,371 bp
  • A to G, chromosome 2 at 160,895,390 bp
  • A to G, chromosome 2 at 163,735,368 bp
  • A to G, chromosome 3 at 62,530,715 bp
  • T to A, chromosome 4 at 137,017,327 bp
  • T to C, chromosome 4 at 148,593,945 bp
  • T to C, chromosome 4 at 149,631,871 bp
  • T to A, chromosome 5 at 66,276,541 bp
  • C to A, chromosome 5 at 128,993,563 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • G to A, chromosome 6 at 41,151,995 bp
  • A to G, chromosome 6 at 100,671,045 bp
  • T to A, chromosome 6 at 123,780,479 bp
  • A to G, chromosome 7 at 17,759,392 bp
  • T to G, chromosome 7 at 48,833,797 bp
  • G to T, chromosome 7 at 85,407,116 bp
  • G to A, chromosome 7 at 86,726,098 bp
  • G to A, chromosome 7 at 104,411,397 bp
  • C to T, chromosome 8 at 70,252,072 bp
  • T to C, chromosome 8 at 71,689,340 bp
  • C to T, chromosome 8 at 72,572,120 bp
  • T to C, chromosome 8 at 83,719,600 bp
  • T to A, chromosome 8 at 85,303,408 bp
  • A to G, chromosome 8 at 105,018,400 bp
  • AGC to AGCCGC, chromosome 9 at 13,621,254 bp
  • AGC to AGCCGC, chromosome 9 at 13,621,275 bp
  • GCA to GCACCA, chromosome 9 at 13,621,276 bp
  • A to T, chromosome 9 at 39,874,082 bp
  • C to T, chromosome 10 at 24,916,791 bp
  • G to A, chromosome 10 at 67,979,813 bp
  • A to T, chromosome 10 at 83,191,186 bp
  • G to T, chromosome 10 at 88,216,075 bp
  • A to G, chromosome 10 at 94,943,515 bp
  • A to T, chromosome 10 at 129,250,995 bp
  • A to G, chromosome 10 at 129,436,931 bp
  • A to T, chromosome 11 at 36,047,116 bp
  • A to T, chromosome 11 at 55,409,971 bp
  • A to G, chromosome 11 at 100,025,258 bp
  • T to A, chromosome 12 at 87,895,499 bp
  • A to T, chromosome 12 at 101,761,818 bp
  • G to T, chromosome 13 at 14,234,342 bp
  • A to G, chromosome 13 at 50,246,190 bp
  • A to G, chromosome 13 at 55,531,921 bp
  • T to A, chromosome 14 at 47,188,961 bp
  • G to A, chromosome 15 at 37,979,832 bp
  • A to T, chromosome 15 at 59,368,459 bp
  • G to A, chromosome 15 at 79,933,823 bp
  • A to T, chromosome 15 at 98,862,923 bp
  • A to G, chromosome 16 at 4,304,380 bp
  • G to A, chromosome 16 at 15,806,096 bp
  • T to C, chromosome 16 at 56,267,150 bp
  • T to C, chromosome 17 at 31,129,570 bp
  • T to C, chromosome 17 at 33,884,740 bp
  • T to A, chromosome 17 at 66,119,060 bp
  • C to A, chromosome 19 at 34,243,418 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7803 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045858-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.