Strain Name:
C57BL/6J-MtgxR7812Btlr/Mmmh
Stock Number:
045867-MU
Citation ID:
RRID:MMRRC_045867-MU
Other Names:
R7812 (G1)
Major Collection:

Strain Information

Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Sbf2
Name: SET binding factor 2
Synonyms: SBF2, 4833411B01Rik, mMTMH1, B430219L04Rik, Mtmr13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319934
HGNC: HGNC:2135
Homologene: 41810
Angpt2
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Adcy10
Name: adenylate cyclase 10
Synonyms: soluble adenylyl cyclase, sAC, 4930431D04Rik, Sacy
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 271639
Homologene: 10188
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Oxr1
Name: oxidation resistance 1
Synonyms: C7B, C7, 2210416C20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170719
VEGA: 15
Homologene: 24993
Abhd17c
Name: abhydrolase domain containing 17C
Synonyms: 2210412D01Rik, Fam108c
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70178
Homologene: 26429
Wwp1
Name: WW domain containing E3 ubiquitin protein ligase 1
Synonyms: SDRP1, Tiul1, AIP5, 8030445B08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107568
Homologene: 21385
Polr1c
Name: polymerase (RNA) I polypeptide C
Synonyms: RPA40, 40kDa, Rpo1-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20016
Homologene: 3586
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: 2310079H06Rik, D030051N19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Trpm7
Name: transient receptor potential cation channel, subfamily M, member 7
Synonyms: 5033407O22Rik, 4833414K03Rik, Ltpr7, CHAK1, CHAK, TRP-PLIK, 2310022G15Rik, LTRPC7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58800
Homologene: 9774
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Auts2
Name: autism susceptibility candidate 2
Synonyms: D830032G16Rik, A730011F23Rik, 2700063G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319974
Homologene: 22907
Vcl
Name: vinculin
Synonyms: metavinculin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22330
VEGA: 14
Homologene: 7594
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Vps35
Name: VPS35 retromer complex component
Synonyms: Mem3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65114
Homologene: 6221
Atf7ip
Name: activating transcription factor 7 interacting protein
Synonyms: ATFa-associated Modulator, AM, 2610204M12Rik, Mcaf1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54343
Homologene: 10051
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
Homologene: 87808
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Cand1
Name: cullin associated and neddylation disassociated 1
Synonyms: 6330512O03Rik, 2310038O07Rik, D10Ertd516e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71902
Homologene: 10202
Furin
Name: furin, paired basic amino acid cleaving enzyme
Synonyms: Fur, PACE, SPC1, Pcsk3, 9130404I01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18550
HGNC: HGNC:8568
Homologene: 1930
Arhgap17
Name: Rho GTPase activating protein 17
Synonyms: WBP15, Nadrin, Rich1, 5730403H17Rik, Nadrin2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70497
Homologene: 9984
Klhl28
Name: kelch-like 28
Synonyms: 2810440N09Rik, 4931401E10Rik, 4122402F11Rik, Btbd5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66689
VEGA: 12
Homologene: 23036
Syngap1
Name: synaptic Ras GTPase activating protein 1 homolog (rat)
Synonyms: Syngap
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240057
Homologene: 84739
Cndp1
Name: carnosine dipeptidase 1
Synonyms: Cn1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 338403
Homologene: 57178
Csnk2b
Name: casein kinase 2, beta polypeptide
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13001
HGNC: HGNC:2460
Homologene: 55572
Atp5pb
Name: ATP synthase peripheral stalk-membrane subunit b
Synonyms: C76477, Atp5f1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11950
HGNC: HGNC:840
Homologene: 1275
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: Ten-m3, 2610100B16Rik, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Cars1
Name: cysteinyl-tRNA synthetase 1
Synonyms: CA3, Cars
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27267
HGNC: HGNC:1493
Homologene: 1328
Lsm14a
Name: LSM14A mRNA processing body assembly factor
Synonyms: 2700023B17Rik, Tral
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67070
Homologene: 40537
1700017B05Rik
Name: RIKEN cDNA 1700017B05 gene
Synonyms: D9Ertd278e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74211
VEGA: 9
Homologene: 19283
Ice1
Name: interactor of little elongation complex ELL subunit 1
Synonyms: BC018507
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218333
VEGA: 13
Homologene: 18902
Dnajc12
Name: DnaJ heat shock protein family (Hsp40) member C12
Synonyms: J domain protein 1, mJDP1, Jdp1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 30045
Homologene: 8492
Nr4a2
Name: nuclear receptor subfamily 4, group A, member 2
Synonyms: HZF-3, RNR-1, Nurr1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18227
HGNC: HGNC:7981
Homologene: 4509
Ldlrad4
Name: low density lipoprotein receptor class A domain containing 4
Synonyms: D330030L18Rik, A430108L08Rik, 8230401C20Rik, D18Ertd653e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 52662
VEGA: 18
HGNC: HGNC:1224
Homologene: 3202
Stxbp4
Name: syntaxin binding protein 4
Synonyms: Synip, 6030470M02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20913
Homologene: 7963
Dgkg
Name: diacylglycerol kinase, gamma
Synonyms: Dagk3, E430001K23Rik, 2900055E17Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110197
HGNC: HGNC:2853
Homologene: 1029
Ces1f
Name: carboxylesterase 1F
Synonyms: TGH-2, CesML1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234564
HGNC: HGNC:1863
Homologene: 134311
Trim44
Name: tripartite motif-containing 44
Synonyms: DIPB, Mc7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 80985
Homologene: 9731
Pcdhb13
Name: protocadherin beta 13
Synonyms: PcdhbM, Pcdbh6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Fgl2
Name: fibrinogen-like protein 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14190
HGNC: HGNC:3696
Homologene: 4864
Vmn2r59
Name: vomeronasal 2, receptor 59
Synonyms: EG628444
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 628444
Homologene: 129683
Mrto4
Name: mRNA turnover 4, ribosome maturation factor
Synonyms: 2610012O22Rik, Mrt4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69902
Homologene: 6379
Or1j12
Name: olfactory receptor family 1 subfamily J member 12
Synonyms: GA_x6K02T2NLDC-33147742-33148680, MOR136-1, Olfr340
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258953
Homologene: 74159
Or52e4
Name: olfactory receptor family 52 subfamily E member 4
Synonyms: GA_x6K02T2PBJ9-7685262-7686200, MOR32-11, Olfr677
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258355
Homologene: 81596
Or1j18
Name: olfactory receptor family 1 subfamily J member 18
Synonyms: GA_x6K02T2NLDC-33428755-33429693, MOR136-9, Olfr347
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258945
Homologene: 51790
Acad11
Name: acyl-Coenzyme A dehydrogenase family, member 11
Synonyms: 5730439E10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102632
Homologene: 49896
Gucy2e
Name: guanylate cyclase 2e
Synonyms: ROS-GC1, GC1, GC-E
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14919
HGNC: HGNC:4689
Homologene: 55442
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Edar
Name: ectodysplasin-A receptor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13608
HGNC: HGNC:2895
Homologene: 7699
St6galnac1
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
Synonyms: ST6GalNAc I, Siat7a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20445
Homologene: 7937
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244668
Homologene: 18956
Slc26a4
Name: solute carrier family 26, member 4
Synonyms: Pds, pendrin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23985
VEGA: 12
HGNC: HGNC:8818
Homologene: 20132
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: 1200011I03Rik, Mamdc3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74762
Homologene: 17780
Fam124b
Name: family with sequence similarity 124, member B
Synonyms: A830043J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241128
Homologene: 65263
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Pbx3
Name: pre B cell leukemia homeobox 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18516
HGNC: HGNC:8634
Homologene: 21243
Sox7
Name: SRY (sex determining region Y)-box 7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20680
VEGA: 14
Homologene: 7949
Adm2
Name: adrenomedullin 2
Synonyms: intermedin, IMD
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223780
VEGA: 15
Homologene: 49801
Scarf2
Name: scavenger receptor class F, member 2
Synonyms: Srec2, SREC-II
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224024
VEGA: 16
Homologene: 17817
Psg25
Name: pregnancy-specific beta-1-glycoprotein 25
Synonyms: cea13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 114868
HGNC: HGNC:1819
Homologene: 110989
Acad8
Name: acyl-Coenzyme A dehydrogenase family, member 8
Synonyms: 2310016C19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66948
HGNC: HGNC:87
Homologene: 8662
Zfp703
Name: zinc finger protein 703
Synonyms: 1110032O19Rik, Csmn1, End2, Zeppo1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 353310
Homologene: 81391
Or10q12
Name: olfactory receptor family 10 subfamily Q member 12
Synonyms: GA_x6K02T2RE5P-4101369-4102328, MOR266-9, Olfr1495
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258341
Homologene: 73965
Trp53i13
Name: transformation related protein 53 inducible protein 13
Synonyms: 2410019G02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216964
Homologene: 16293
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 80,213,634 bp
  • A to G, chromosome 1 at 165,515,369 bp
  • T to C, chromosome 2 at 34,224,466 bp
  • T to A, chromosome 2 at 36,453,278 bp
  • A to T, chromosome 2 at 36,734,725 bp
  • A to G, chromosome 2 at 57,112,418 bp
  • A to T, chromosome 2 at 91,766,566 bp
  • G to T, chromosome 2 at 102,400,144 bp
  • A to G, chromosome 2 at 126,799,316 bp
  • A to G, chromosome 3 at 105,943,841 bp
  • G to A, chromosome 4 at 19,639,991 bp
  • G to A, chromosome 4 at 45,906,952 bp
  • T to G, chromosome 4 at 55,008,509 bp
  • A to G, chromosome 4 at 139,347,967 bp
  • C to A, chromosome 5 at 21,372,898 bp
  • T to A, chromosome 5 at 108,180,833 bp
  • T to A, chromosome 5 at 115,593,692 bp
  • C to T, chromosome 5 at 131,472,446 bp
  • G to A, chromosome 6 at 136,603,417 bp
  • A to T, chromosome 7 at 18,521,168 bp
  • A to G, chromosome 7 at 34,388,876 bp
  • A to T, chromosome 7 at 42,045,772 bp
  • T to G, chromosome 7 at 49,597,173 bp
  • T to C, chromosome 7 at 80,395,974 bp
  • G to T, chromosome 7 at 84,151,416 bp
  • T to C, chromosome 7 at 105,056,687 bp
  • C to T, chromosome 7 at 110,449,963 bp
  • T to C, chromosome 7 at 123,280,067 bp
  • T to A, chromosome 7 at 143,570,047 bp
  • T to C, chromosome 8 at 18,692,145 bp
  • T to A, chromosome 8 at 26,979,878 bp
  • T to C, chromosome 8 at 48,276,300 bp
  • T to C, chromosome 8 at 85,284,189 bp
  • A to G, chromosome 8 at 93,258,310 bp
  • A to C, chromosome 8 at 125,491,595 bp
  • A to T, chromosome 9 at 26,979,180 bp
  • C to A, chromosome 9 at 57,257,858 bp
  • T to G, chromosome 9 at 104,095,548 bp
  • A to G, chromosome 10 at 11,151,991 bp
  • A to G, chromosome 10 at 58,467,402 bp
  • A to G, chromosome 10 at 58,630,104 bp
  • A to G, chromosome 10 at 63,407,126 bp
  • A to T, chromosome 10 at 119,217,959 bp
  • A to G, chromosome 11 at 69,226,243 bp
  • A to T, chromosome 11 at 77,508,840 bp
  • A to G, chromosome 11 at 90,594,828 bp
  • A to T, chromosome 11 at 94,444,054 bp
  • G to T, chromosome 11 at 116,769,101 bp
  • T to A, chromosome 12 at 31,544,450 bp
  • T to A, chromosome 12 at 55,719,628 bp
  • T to C, chromosome 12 at 64,943,589 bp
  • T to A, chromosome 13 at 70,603,005 bp
  • A to G, chromosome 14 at 20,995,090 bp
  • C to T, chromosome 14 at 63,948,232 bp
  • A to G, chromosome 14 at 79,565,558 bp
  • T to A, chromosome 15 at 41,751,742 bp
  • A to T, chromosome 15 at 89,324,164 bp
  • G to A, chromosome 16 at 17,803,828 bp
  • C to G, chromosome 16 at 22,566,415 bp
  • A to T, chromosome 17 at 25,852,558 bp
  • A to C, chromosome 17 at 26,941,504 bp
  • A to G, chromosome 17 at 29,843,141 bp
  • A to T, chromosome 17 at 35,120,455 bp
  • G to A, chromosome 17 at 46,246,127 bp
  • T to A, chromosome 18 at 37,442,592 bp
  • C to A, chromosome 18 at 68,106,671 bp
  • G to T, chromosome 18 at 84,637,869 bp
  • T to C, chromosome 19 at 13,769,016 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7812 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045867-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.