Strain Name:
C57BL/6J-MtgxR7817Btlr/Mmmh
Stock Number:
045871-MU
Citation ID:
RRID:MMRRC_045871-MU
Other Names:
R7817 (G1)
Major Collection:

Strain Information

Notch2
Name: notch 2
Synonyms: N2, Motch B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: MyHC-I, Myhcb, MYH-beta/slow, Myhc-b, betaMHC, beta-MHC, B-MHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd, Edd1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Srr
Name: serine racemase
Synonyms: Rgsc34, M100034
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27364
Homologene: 22775
Rorb
Name: RAR-related orphan receptor beta
Synonyms: RZR-beta, Rorbeta, Nr1f2, hstp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225998
Homologene: 38250
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, Ht31, 1700026G02Rik, 5830460E08Rik, PROTO-LBC, 5730522G15Rik, PROTO-LB
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Unc13d
Name: unc-13 homolog D
Synonyms: 2610108D09Rik, Munc13-4, Jinx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Tomm70a
Name: translocase of outer mitochondrial membrane 70A
Synonyms: Tomm70a, D16Ium22e, Tom70, 2610044B22Rik, D16Wsu109e, D16Ium22
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 28185
VEGA: 16
Homologene: 40112
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: Solo, 6720464I07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Cftr
Name: cystic fibrosis transmembrane conductance regulator
Synonyms: Abcc7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12638
HGNC: HGNC:1884
Homologene: 55465
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Cacng3
Name: calcium channel, voltage-dependent, gamma subunit 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54376
HGNC: HGNC:1407
Homologene: 4767
Glud1
Name: glutamate dehydrogenase 1
Synonyms: Gdh-X, Glud
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14661
Homologene: 55885
Rad1
Name: RAD1 checkpoint DNA exonuclease
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19355
HGNC: HGNC:9806
Homologene: 37695
Rb1
Name: RB transcriptional corepressor 1
Synonyms: Rb-1, pRb, retinoblastoma 1, Rb
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19645
HGNC: HGNC:9884
Homologene: 272
Galnt3
Name: polypeptide N-acetylgalactosaminyltransferase 3
Synonyms: ppGaNTase-T3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14425
HGNC: HGNC:4125
Homologene: 55827
Nek10
Name: NIMA (never in mitosis gene a)- related kinase 10
Synonyms: LOC238944
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 674895
Homologene: 130947
Pcdhb11
Name: protocadherin beta 11
Synonyms: PcdhbK, Pcdhb5E
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93882
HGNC: HGNC:8690
Homologene: 62178
Dscam
Name: DS cell adhesion molecule
Synonyms: 4932410A21Rik, Down syndrome cell adhesion molecule
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13508
HGNC: HGNC:3039
Homologene: 74393
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Nlrc3
Name: NLR family, CARD domain containing 3
Synonyms: Caterpiller 16.2, CLR16.2, D230007K08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268857
Homologene: 18720
Pik3r5
Name: phosphoinositide-3-kinase regulatory subunit 5
Synonyms: Foap2, p101
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320207
Homologene: 8627
Or9m1b
Name: olfactory receptor family 9 subfamily M member 1B
Synonyms: Olfr1160, GA_x6K02T2Q125-49498697-49497765, MOR173-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258643
Homologene: 74192
BC005537
Name: cDNA sequence BC005537
Synonyms: 8030460C05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 79555
Homologene: 11551
Zfp518b
Name: zinc finger protein 518B
Synonyms: 6820424L24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100515
Homologene: 19115
Serpina3b
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonyms: alpha-1 antiproteinase, A030003A19Rik, 6A1, antitrypsin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271047
HGNC: HGNC:16
Homologene: 120222
Cttnbp2
Name: cortactin binding protein 2
Synonyms: Cortbp2, 4732477G22Rik, 3010022N24Rik, 9130022E09Rik, ORF4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 30785
Homologene: 14125
Prdm9
Name: PR domain containing 9
Synonyms: Meisetz, G1-419-29, repro7, Rcr1, Dsbc1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213389
Homologene: 104139
Zfp27
Name: zinc finger protein 27
Synonyms: mkr-4, Zfp-27
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22689
Homologene: 81823
Trim62
Name: tripartite motif-containing 62
Synonyms: Dear1, 6330414G21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67525
Homologene: 10071
Psg26
Name: pregnancy-specific beta-1-glycoprotein 26
Synonyms: EG574429, cea14
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 574429
Homologene: 110989
Nipsnap3a
Name: nipsnap homolog 3A
Synonyms: 1700054F22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73398
Homologene: 136268
Vmn1r230
Name: vomeronasal 1 receptor 230
Synonyms: V1re8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171231
Homologene: 136306
Adamts17
Name: ADAM metallopeptidase with thrombospondin type 1 motif 17
Synonyms: AU023434
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233332
Homologene: 16373
Pcdhb3
Name: protocadherin beta 3
Synonyms: PcdhbC
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93874
HGNC: HGNC:8688
Homologene: 115665
Bivm
Name: basic, immunoglobulin-like variable motif containing
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 246229
Homologene: 9783
Nfxl1
Name: nuclear transcription factor, X-box binding-like 1
Synonyms: TCF9, LOC381696, D430033A06Rik, 1700012H24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100978
Homologene: 26752
Zfp354c
Name: zinc finger protein 354C
Synonyms: 5330421P20Rik, Kid3, AJ18
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30944
Homologene: 56606
Ryk
Name: receptor-like tyrosine kinase
Synonyms: Vik, ERK-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20187
Homologene: 68287
Vmn1r159
Name: vomeronasal 1 receptor 159
Synonyms: Gm16507
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 670857
Homologene: 104166
Krt9
Name: keratin 9
Synonyms: Krt1-9, K9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Pars2
Name: prolyl-tRNA synthetase (mitochondrial)(putative)
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230577
Homologene: 5830
Timd2
Name: T cell immunoglobulin and mucin domain containing 2
Synonyms: Tim2, TIM-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171284
Homologene: 82236
Gabra4
Name: gamma-aminobutyric acid type A receptor subunit alpha 4
Synonyms: Gabra-4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14397
HGNC: HGNC:4078
Homologene: 631
Gm47189
Name: predicted gene, 47189
Type: Gene
Species: Mouse
Chromosome: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 44,126,401 bp
  • A to G, chromosome 2 at 66,095,899 bp
  • T to C, chromosome 2 at 88,006,011 bp
  • T to C, chromosome 3 at 98,107,127 bp
  • T to A, chromosome 4 at 52,997,279 bp
  • T to A, chromosome 4 at 106,654,079 bp
  • T to C, chromosome 4 at 128,900,685 bp
  • T to C, chromosome 5 at 38,672,398 bp
  • A to G, chromosome 5 at 71,640,863 bp
  • T to C, chromosome 5 at 72,514,289 bp
  • A to G, chromosome 6 at 18,267,968 bp
  • G to C, chromosome 6 at 18,426,093 bp
  • A to G, chromosome 7 at 18,482,647 bp
  • T to A, chromosome 7 at 22,843,062 bp
  • T to C, chromosome 7 at 29,896,390 bp
  • T to C, chromosome 7 at 66,909,476 bp
  • G to A, chromosome 7 at 75,730,465 bp
  • G to A, chromosome 7 at 122,768,599 bp
  • C to T, chromosome 9 at 102,891,233 bp
  • T to G, chromosome 10 at 20,443,305 bp
  • A to T, chromosome 11 at 46,670,954 bp
  • TCACACTCGGCACA to TCACA, chromosome 11 at 50,815,240 bp
  • T to C, chromosome 11 at 68,493,657 bp
  • A to G, chromosome 11 at 74,908,698 bp
  • A to G, chromosome 11 at 86,725,123 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • A to T, chromosome 11 at 116,076,283 bp
  • A to G, chromosome 12 at 104,132,964 bp
  • C to T, chromosome 13 at 24,803,399 bp
  • A to G, chromosome 13 at 114,820,846 bp
  • C to T, chromosome 14 at 15,001,017 bp
  • A to T, chromosome 14 at 34,329,287 bp
  • A to G, chromosome 14 at 41,770,054 bp
  • C to G, chromosome 14 at 54,988,801 bp
  • A to T, chromosome 14 at 73,198,543 bp
  • A to T, chromosome 14 at 96,136,750 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • T to C, chromosome 15 at 10,493,318 bp
  • C to G, chromosome 15 at 27,749,866 bp
  • G to A, chromosome 15 at 37,979,832 bp
  • C to T, chromosome 15 at 47,857,960 bp
  • C to T, chromosome 16 at 3,965,463 bp
  • C to T, chromosome 16 at 57,144,773 bp
  • T to C, chromosome 16 at 96,640,864 bp
  • G to A, chromosome 17 at 15,559,049 bp
  • T to A, chromosome 17 at 20,846,561 bp
  • T to A, chromosome 18 at 37,302,929 bp
  • A to G, chromosome 18 at 37,423,909 bp
  • A to T, chromosome 19 at 18,988,096 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7817 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045871-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.