Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7817Btlr/Mmmh
Stock Number:
045871-MU
Citation ID:
RRID:MMRRC_045871-MU
Other Names:
R7817 (G1)
Major Collection:

Strain Information

Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Ubr5
Name: ubiquitin protein ligase E3 component n-recognin 5
Synonyms: 4432411E13Rik, Edd1, Edd
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 70790
VEGA: 15
Homologene: 9295
Srr
Name: serine racemase
Synonyms: M100034, Rgsc34
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27364
Homologene: 22775
Rorb
Name: RAR-related orphan receptor beta
Synonyms: RZR-beta, Nr1f2, Rorbeta, hstp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225998
Homologene: 38250
Cltc
Name: clathrin heavy chain
Synonyms: CHC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67300
HGNC: HGNC:2092
Homologene: 3572
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 44,126,401 bp
  • A to G, chromosome 2 at 66,095,899 bp
  • T to C, chromosome 2 at 88,006,011 bp
  • T to C, chromosome 3 at 98,107,127 bp
  • T to A, chromosome 4 at 52,997,279 bp
  • T to A, chromosome 4 at 106,654,079 bp
  • T to C, chromosome 4 at 128,900,685 bp
  • T to C, chromosome 5 at 38,672,398 bp
  • A to G, chromosome 5 at 71,640,863 bp
  • T to C, chromosome 5 at 72,514,289 bp
  • A to G, chromosome 6 at 18,267,968 bp
  • G to C, chromosome 6 at 18,426,093 bp
  • A to G, chromosome 7 at 18,482,647 bp
  • T to A, chromosome 7 at 22,843,062 bp
  • T to C, chromosome 7 at 29,896,390 bp
  • T to C, chromosome 7 at 66,909,476 bp
  • G to A, chromosome 7 at 75,730,465 bp
  • G to A, chromosome 7 at 122,768,599 bp
  • C to T, chromosome 9 at 102,891,233 bp
  • T to G, chromosome 10 at 20,443,305 bp
  • A to T, chromosome 11 at 46,670,954 bp
  • TCACACTCGGCACA to TCACA, chromosome 11 at 50,815,240 bp
  • T to C, chromosome 11 at 68,493,657 bp
  • A to G, chromosome 11 at 74,908,698 bp
  • A to G, chromosome 11 at 86,725,123 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • A to T, chromosome 11 at 116,076,283 bp
  • A to G, chromosome 12 at 104,132,964 bp
  • C to T, chromosome 13 at 24,803,399 bp
  • A to G, chromosome 13 at 114,820,846 bp
  • C to T, chromosome 14 at 15,001,017 bp
  • A to T, chromosome 14 at 34,329,287 bp
  • A to G, chromosome 14 at 41,770,054 bp
  • C to G, chromosome 14 at 54,988,801 bp
  • A to T, chromosome 14 at 73,198,543 bp
  • A to T, chromosome 14 at 96,136,750 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • T to C, chromosome 15 at 10,493,318 bp
  • C to G, chromosome 15 at 27,749,866 bp
  • G to A, chromosome 15 at 37,979,832 bp
  • C to T, chromosome 15 at 47,857,960 bp
  • C to T, chromosome 16 at 3,965,463 bp
  • C to T, chromosome 16 at 57,144,773 bp
  • T to C, chromosome 16 at 96,640,864 bp
  • G to A, chromosome 17 at 15,559,049 bp
  • T to A, chromosome 17 at 20,846,561 bp
  • T to A, chromosome 18 at 37,302,929 bp
  • A to G, chromosome 18 at 37,423,909 bp
  • A to T, chromosome 19 at 18,988,096 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7817 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045871-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.