Strain Name:
C57BL/6J-MtgxR7819Btlr/Mmmh
Stock Number:
045873-MU
Citation ID:
RRID:MMRRC_045873-MU
Other Names:
R7819 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: c-KIT, belly-spot, Tr-kit, SCO5, Dominant white spotting, SCO1, Gsfsow3, Gsfsco5, SOW3, Gsfsco1, Steel Factor Receptor, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Prkar2a
Name: protein kinase, cAMP dependent regulatory, type II alpha
Synonyms: RII(alpha), 1110061A24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19087
HGNC: HGNC:9391
Homologene: 3064
Map2k5
Name: mitogen-activated protein kinase kinase 5
Synonyms: MEK5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23938
VEGA: 9
HGNC: HGNC:6845
Homologene: 115933
Pi4k2a
Name: phosphatidylinositol 4-kinase type 2 alpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 84095
VEGA: 19
Homologene: 101681
Prkd3
Name: protein kinase D3
Synonyms: Prkcn, 5730497N19Rik, 4930557O20Rik, PKD3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Ppp1r37
Name: protein phosphatase 1, regulatory subunit 37
Synonyms: Lrrc68
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232947
Homologene: 17851
Ptpra
Name: protein tyrosine phosphatase receptor type A
Synonyms: PTP[a], PTPalpha, RPTPalpha, RPTRalpha, Ptpa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19262
HGNC: HGNC:9664
Homologene: 20621
B3galnt1
Name: UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1
Synonyms: Mbrn 1, Brainiac 1, Globoside blood group, B3galt3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26879
HGNC: HGNC:918
Homologene: 32457
Gmps
Name: guanine monophosphate synthetase
Synonyms: Gm9479
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229363
HGNC: HGNC:4378
Homologene: 68367
Ints1
Name: integrator complex subunit 1
Synonyms: 1110015K06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68510
Homologene: 53111
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: 2310065E01Rik, 9530001P15Rik, Ponsin, Sh3d5, CAP, c-Cbl-associated protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Npepps
Name: aminopeptidase puromycin sensitive
Synonyms: MP100, Psa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19155
HGNC: HGNC:7900
Homologene: 36199
Nhsl3
Name: NHS like 3
Synonyms: C77080
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 97130
Homologene: 45837
Ezh1
Name: enhancer of zeste 1 polycomb repressive complex 2 subunit
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14055
HGNC: HGNC:3526
Homologene: 20458
Syn3
Name: synapsin III
Synonyms: Synapsin IIIa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27204
Homologene: 68320
Gpsm1
Name: G-protein signalling modulator 1 (AGS3-like, C. elegans)
Synonyms: Ags3, 1810037C22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67839
Homologene: 16987
Casp12
Name: caspase 12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12364
Homologene: 7654
Fzd3
Name: frizzled class receptor 3
Synonyms: Fz3, D930050A07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14365
HGNC: HGNC:4041
Homologene: 23004
Rnf103
Name: ring finger protein 103
Synonyms: Zfp103, kf-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22644
Homologene: 4146
Ighmbp2
Name: immunoglobulin mu DNA binding protein 2
Synonyms: AEP, Catf1, p110 subunit, Smbp2, sma, RIPE3b1, Smubp2, Smbp-2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20589
HGNC: HGNC:5542
Homologene: 1642
Cdc37
Name: cell division cycle 37
Synonyms: p50Cdc37
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12539
VEGA: 9
HGNC: HGNC:1735
Homologene: 38268
Ikbkb
Name: inhibitor of kappaB kinase beta
Synonyms: IKKbeta, IKK[b], IKK-beta, IKK2, IKK-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16150
HGNC: HGNC:5960
Homologene: 7782
Cert1
Name: ceramide transporter 1
Synonyms: 2810404O15Rik, Cert, GPBP, 9230101K08Rik, ceramide transport protein, Col4a3bp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68018
VEGA: 13
HGNC: HGNC:2205
Homologene: 4173
Prmt9
Name: protein arginine methyltransferase 9
Synonyms: Prmt10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102182
Homologene: 16298
Pcdhb18
Name: protocadherin beta 18
Synonyms: PcdhbR, Pcdhb9
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Crppa
Name: CDP-L-ribitol pyrophosphorylase A
Synonyms: 4930579E17Rik, Ispd
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75847
VEGA: 12
Homologene: 45614
Chmp3
Name: charged multivesicular body protein 3
Synonyms: 9130011K15Rik, D6Ertd286e, 4921505F14Rik, CGI-49, 25.1, Vps24
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66700
Homologene: 6368
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, Dnhd3, Dnahc2, 2900022L05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Lamc3
Name: laminin gamma 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23928
HGNC: HGNC:6494
Homologene: 21222
Pde9a
Name: phosphodiesterase 9A
Synonyms: PDE9A1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18585
HGNC: HGNC:8795
Homologene: 113565
Slc16a12
Name: solute carrier family 16 (monocarboxylic acid transporters), member 12
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240638
Homologene: 130007
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Stard9
Name: StAR related lipid transfer domain containing 9
Synonyms: N-3 kinesin, Kif16a, E230025N21Rik, 4831403C07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668880
Homologene: 130712
Eln
Name: elastin
Synonyms: tropoelastin, E030024M20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13717
HGNC: HGNC:3327
Capn3
Name: calpain 3
Synonyms: Capa3, Capa-3, p94, Lp82
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12335
HGNC: HGNC:1480
Homologene: 52
Mgat3
Name: mannoside acetylglucosaminyltransferase 3
Synonyms: GnT-III, 1110038J12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17309
VEGA: 15
HGNC: HGNC:7046
Homologene: 31088
Cfap251
Name: cilia and flagella associated protein 251
Synonyms: 4930415N18Rik, Wdr66, 4933428F06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269701
Homologene: 16964
Itga1
Name: integrin alpha 1
Synonyms: E130012M19Rik, CD49A, Vla1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109700
VEGA: 13
HGNC: HGNC:6134
Homologene: 57137
Abcg3
Name: ATP binding cassette subfamily G member 3
Synonyms: Abcp2, Mxr2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27405
HGNC: HGNC:74
Homologene: 86845
D630003M21Rik
Name: RIKEN cDNA D630003M21 gene
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228846
Homologene: 18598
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Cep89
Name: centrosomal protein 89
Synonyms: Ccdc123, 2610507L03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72140
Homologene: 12444
Ccdc96
Name: coiled-coil domain containing 96
Synonyms: 4921513E08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66717
Homologene: 32639
Csgalnact2
Name: chondroitin sulfate N-acetylgalactosaminyltransferase 2
Synonyms: 4632415D10Rik, Galnact2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78752
Homologene: 23109
Ddx31
Name: DEAD/H box helicase 31
Synonyms: DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31, 5830444G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227674
Homologene: 6389
Ica1l
Name: islet cell autoantigen 1-like
Synonyms: Als2cr15, b2b3465Clo, 1700030B17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70375
Homologene: 16323
5730596B20Rik
Name: RIKEN cDNA 5730596B20 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77580
VEGA: 6
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: C130090D05Rik, Kv12.1, ELK1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Slfn8
Name: schlafen 8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276950
Homologene: 45432
Il1rap
Name: interleukin 1 receptor accessory protein
Synonyms: IL-1R AcP, IL-1RAcP, 6430709H04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16180
HGNC: HGNC:5995
Homologene: 1643
Itih4
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16427
HGNC: HGNC:6169
Homologene: 1670
Idh1
Name: isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms: E030024J03Rik, IDPc, Id-1, Idh-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15926
HGNC: HGNC:5382
Homologene: 21195
Ing2
Name: inhibitor of growth family, member 2
Synonyms: Ing1l, ING2, P33ING2, 2810011M06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69260
HGNC: HGNC:6063
Homologene: 20388
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Plscr4
Name: phospholipid scramblase 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235527
Homologene: 23217
Ctsh
Name: cathepsin H
Synonyms: Cat H
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13036
HGNC: HGNC:2535
Homologene: 36159
Vmn1r72
Name: vomeronasal 1 receptor 72
Synonyms: V1rg1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252905
Homologene: 74318
Dip2a
Name: disco interacting protein 2 homolog A
Synonyms: Dip2, 4931420H10Rik, Kiaa0184-hp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64451
Homologene: 41012
Or6c66b
Name: olfactory receptor family 6 subfamily C member 66B
Synonyms: GA_x6K02T2PULF-11219415-11220350, MOR108-2, Olfr792
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258150
Homologene: 133881
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70859
Homologene: 52823
Gbp9
Name: guanylate-binding protein 9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 236573
Homologene: 128731
Arhgap11a
Name: Rho GTPase activating protein 11A
Synonyms: 6530401L14Rik, GAP (1-12)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228482
Homologene: 8862
Tspo2
Name: translocator protein 2
Synonyms: 2510027D20Rik, Bzrpl1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70026
Homologene: 12344
Clgn
Name: calmegin
Synonyms: 4930459O04Rik, Cln, A2/6, calnexin-t
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12745
HGNC: HGNC:2060
Homologene: 68392
Rpusd4
Name: RNA pseudouridylate synthase domain containing 4
Synonyms: 2410001E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71989
Homologene: 32794
Ahr
Name: aryl-hydrocarbon receptor
Synonyms: Ahh, Ah, bHLHe76, Ahre, dioxin receptor, In
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11622
HGNC: HGNC:348
Homologene: 1224
Apol8
Name: apolipoprotein L 8
Synonyms: Apol2, 9830006J20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239552
VEGA: 15
Homologene: 12785
Or10a3
Name: olfactory receptor family 10 subfamily A member 3
Synonyms: GA_x6K02T2PBJ9-11211854-11210853, MOR268-5, Olfr518
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258303
HGNC: HGNC:8162
Homologene: 133601
Map10
Name: microtubule-associated protein 10
Synonyms: 4933403G14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74393
Homologene: 10416
Defb40
Name: defensin beta 40
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 360217
Homologene: 86851
Zfp354b
Name: zinc finger protein 354B
Synonyms: Kid2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27274
Homologene: 32187
Crb2
Name: crumbs family member 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241324
Homologene: 45474
Xbp1
Name: X-box binding protein 1
Synonyms: D11Ertd39e, TREB-5, XBP-1, TREB5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22433
Homologene: 3722
Oxgr1
Name: oxoglutarate (alpha-ketoglutarate) receptor 1
Synonyms: P2Y15, Gpr99, LOC239283, Cysltr3, Gpr80
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239283
VEGA: 14
HGNC: HGNC:4531
Homologene: 25878
Hsfy2
Name: heat shock transcription factor, Y-linked 2
Synonyms: 4933413G11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71066
Homologene: 134090
Adra1b
Name: adrenergic receptor, alpha 1b
Synonyms: alpha1B-adrenergic receptor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11548
HGNC: HGNC:278
Homologene: 55477
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CKLFH1, Cklfsf1, CHLFH1a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Sco1
Name: SCO1 cytochrome c oxidase assembly protein
Synonyms: 2610001C07Rik, D11Bwg1310e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52892
Homologene: 3374
Pcdhga5
Name: protocadherin gamma subfamily A, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93713
HGNC: HGNC:8703
Homologene: 69263
Gltp
Name: glycolipid transfer protein
Synonyms: 1110001F24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56356
Homologene: 41133
Zfp582
Name: zinc finger protein 582
Synonyms: Gm3854
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100416477
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 56,636,259 bp
  • A to T, chromosome 1 at 60,015,794 bp
  • A to G, chromosome 1 at 65,165,118 bp
  • A to T, chromosome 1 at 179,768,315 bp
  • T to C, chromosome 2 at 26,339,693 bp
  • T to G, chromosome 2 at 28,892,451 bp
  • T to C, chromosome 2 at 31,921,763 bp
  • T to A, chromosome 2 at 37,791,591 bp
  • T to A, chromosome 2 at 113,834,918 bp
  • T to C, chromosome 2 at 120,464,165 bp
  • T to C, chromosome 2 at 120,700,984 bp
  • T to C, chromosome 2 at 130,504,206 bp
  • T to C, chromosome 2 at 158,216,798 bp
  • G to A, chromosome 3 at 63,985,627 bp
  • T to C, chromosome 3 at 69,575,775 bp
  • T to A, chromosome 4 at 113,559,835 bp
  • A to G, chromosome 4 at 129,222,483 bp
  • A to T, chromosome 5 at 36,485,985 bp
  • A to G, chromosome 5 at 75,645,932 bp
  • T to C, chromosome 5 at 104,977,728 bp
  • T to C, chromosome 5 at 105,103,879 bp
  • A to G, chromosome 5 at 114,674,100 bp
  • A to G, chromosome 5 at 123,254,259 bp
  • A to T, chromosome 5 at 134,737,181 bp
  • A to T, chromosome 5 at 139,760,767 bp
  • C to G, chromosome 6 at 52,179,274 bp
  • A to G, chromosome 6 at 71,508,930 bp
  • T to A, chromosome 6 at 71,561,024 bp
  • A to C, chromosome 6 at 118,121,089 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to C, chromosome 7 at 6,354,166 bp
  • A to G, chromosome 7 at 11,669,625 bp
  • A to G, chromosome 7 at 19,534,064 bp
  • A to T, chromosome 7 at 35,432,543 bp
  • T to A, chromosome 7 at 108,881,403 bp
  • T to A, chromosome 8 at 18,975,034 bp
  • A to G, chromosome 8 at 22,671,726 bp
  • G to A, chromosome 8 at 47,669,028 bp
  • T to C, chromosome 8 at 77,568,344 bp
  • A to T, chromosome 8 at 83,408,200 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • TCAGTTGTCCAG to TCAG, chromosome 8 at 125,670,521 bp
  • T to C, chromosome 9 at 5,352,805 bp
  • A to G, chromosome 9 at 21,140,964 bp
  • A to G, chromosome 9 at 35,267,932 bp
  • T to C, chromosome 9 at 63,358,018 bp
  • T to A, chromosome 9 at 90,060,503 bp
  • C to T, chromosome 9 at 92,490,790 bp
  • T to A, chromosome 9 at 108,745,545 bp
  • A to G, chromosome 10 at 76,291,028 bp
  • A to T, chromosome 10 at 86,055,540 bp
  • A to T, chromosome 10 at 129,540,693 bp
  • G to A, chromosome 11 at 5,524,886 bp
  • A to T, chromosome 11 at 43,835,367 bp
  • G to A, chromosome 11 at 50,923,805 bp
  • A to G, chromosome 11 at 67,058,393 bp
  • T to C, chromosome 11 at 69,516,593 bp
  • T to G, chromosome 11 at 83,004,255 bp
  • C to A, chromosome 11 at 97,248,269 bp
  • T to C, chromosome 11 at 101,194,914 bp
  • A to G, chromosome 12 at 35,510,000 bp
  • A to G, chromosome 12 at 36,381,903 bp
  • A to T, chromosome 13 at 96,629,067 bp
  • T to C, chromosome 13 at 115,049,301 bp
  • T to C, chromosome 14 at 30,901,663 bp
  • A to G, chromosome 14 at 65,235,326 bp
  • TGGCGGCGGCGGCGGCGGCGGC to TGGCGGCGGCGGCGGCGGCGGCGGC, chromosome 14 at 75,125,221 bp
  • T to C, chromosome 14 at 120,022,869 bp
  • C to T, chromosome 15 at 77,749,759 bp
  • G to T, chromosome 15 at 80,211,772 bp
  • T to A, chromosome 16 at 26,722,401 bp
  • A to T, chromosome 17 at 31,460,200 bp
  • A to T, chromosome 17 at 48,449,957 bp
  • A to G, chromosome 17 at 52,956,715 bp
  • A to T, chromosome 17 at 78,972,501 bp
  • T to C, chromosome 18 at 37,491,255 bp
  • G to A, chromosome 18 at 37,696,580 bp
  • C to T, chromosome 19 at 3,267,276 bp
  • A to G, chromosome 19 at 34,675,179 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • G to A, chromosome 19 at 42,090,574 bp
  • A to G, chromosome 19 at 56,335,288 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7819 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045873-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.