Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7819Btlr/Mmmh
Stock Number:
045873-MU
Citation ID:
RRID:MMRRC_045873-MU
Other Names:
R7819 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Prkar2a
Name: protein kinase, cAMP dependent regulatory, type II alpha
Synonyms: RII(alpha), 1110061A24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19087
HGNC: HGNC:9391
Homologene: 3064
Map2k5
Name: mitogen-activated protein kinase kinase 5
Synonyms: MEK5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23938
VEGA: 9
HGNC: HGNC:6845
Homologene: 115933
Pi4k2a
Name: phosphatidylinositol 4-kinase type 2 alpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 84095
VEGA: 19
Homologene: 101681
Prkd3
Name: protein kinase D3
Synonyms: 4930557O20Rik, 5730497N19Rik, PKD3, Prkcn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75292
HGNC: HGNC:9408
Homologene: 2055
Ppp1r37
Name: protein phosphatase 1, regulatory subunit 37
Synonyms: Lrrc68
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232947
Homologene: 17851
Ptpra
Name: protein tyrosine phosphatase receptor type A
Synonyms: RPTRalpha, PTPalpha, PTP[a], Ptpa, RPTPalpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19262
HGNC: HGNC:9664
Homologene: 20621
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 56,636,259 bp
  • A to T, chromosome 1 at 60,015,794 bp
  • A to G, chromosome 1 at 65,165,118 bp
  • A to T, chromosome 1 at 179,768,315 bp
  • T to C, chromosome 2 at 26,339,693 bp
  • T to G, chromosome 2 at 28,892,451 bp
  • T to C, chromosome 2 at 31,921,763 bp
  • T to A, chromosome 2 at 37,791,591 bp
  • T to A, chromosome 2 at 113,834,918 bp
  • T to C, chromosome 2 at 120,464,165 bp
  • T to C, chromosome 2 at 120,700,984 bp
  • T to C, chromosome 2 at 130,504,206 bp
  • T to C, chromosome 2 at 158,216,798 bp
  • G to A, chromosome 3 at 63,985,627 bp
  • T to C, chromosome 3 at 69,575,775 bp
  • T to A, chromosome 4 at 113,559,835 bp
  • A to G, chromosome 4 at 129,222,483 bp
  • A to T, chromosome 5 at 36,485,985 bp
  • A to G, chromosome 5 at 75,645,932 bp
  • T to C, chromosome 5 at 104,977,728 bp
  • T to C, chromosome 5 at 105,103,879 bp
  • A to G, chromosome 5 at 114,674,100 bp
  • A to G, chromosome 5 at 123,254,259 bp
  • A to T, chromosome 5 at 134,737,181 bp
  • A to T, chromosome 5 at 139,760,767 bp
  • C to G, chromosome 6 at 52,179,274 bp
  • A to G, chromosome 6 at 71,508,930 bp
  • T to A, chromosome 6 at 71,561,024 bp
  • A to C, chromosome 6 at 118,121,089 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to C, chromosome 7 at 6,354,166 bp
  • A to G, chromosome 7 at 11,669,625 bp
  • A to G, chromosome 7 at 19,534,064 bp
  • A to T, chromosome 7 at 35,432,543 bp
  • T to A, chromosome 7 at 108,881,403 bp
  • T to A, chromosome 8 at 18,975,034 bp
  • A to G, chromosome 8 at 22,671,726 bp
  • G to A, chromosome 8 at 47,669,028 bp
  • T to C, chromosome 8 at 77,568,344 bp
  • A to T, chromosome 8 at 83,408,200 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • TCAGTTGTCCAG to TCAG, chromosome 8 at 125,670,521 bp
  • T to C, chromosome 9 at 5,352,805 bp
  • A to G, chromosome 9 at 21,140,964 bp
  • A to G, chromosome 9 at 35,267,932 bp
  • T to C, chromosome 9 at 63,358,018 bp
  • T to A, chromosome 9 at 90,060,503 bp
  • C to T, chromosome 9 at 92,490,790 bp
  • T to A, chromosome 9 at 108,745,545 bp
  • A to G, chromosome 10 at 76,291,028 bp
  • A to T, chromosome 10 at 86,055,540 bp
  • A to T, chromosome 10 at 129,540,693 bp
  • G to A, chromosome 11 at 5,524,886 bp
  • A to T, chromosome 11 at 43,835,367 bp
  • G to A, chromosome 11 at 50,923,805 bp
  • A to G, chromosome 11 at 67,058,393 bp
  • T to C, chromosome 11 at 69,516,593 bp
  • T to G, chromosome 11 at 83,004,255 bp
  • C to A, chromosome 11 at 97,248,269 bp
  • T to C, chromosome 11 at 101,194,914 bp
  • A to G, chromosome 12 at 35,510,000 bp
  • A to G, chromosome 12 at 36,381,903 bp
  • A to T, chromosome 13 at 96,629,067 bp
  • T to C, chromosome 13 at 115,049,301 bp
  • T to C, chromosome 14 at 30,901,663 bp
  • A to G, chromosome 14 at 65,235,326 bp
  • TGGCGGCGGCGGCGGCGGCGGC to TGGCGGCGGCGGCGGCGGCGGCGGC, chromosome 14 at 75,125,221 bp
  • T to C, chromosome 14 at 120,022,869 bp
  • C to T, chromosome 15 at 77,749,759 bp
  • G to T, chromosome 15 at 80,211,772 bp
  • T to A, chromosome 16 at 26,722,401 bp
  • A to T, chromosome 17 at 31,460,200 bp
  • A to T, chromosome 17 at 48,449,957 bp
  • A to G, chromosome 17 at 52,956,715 bp
  • A to T, chromosome 17 at 78,972,501 bp
  • T to C, chromosome 18 at 37,491,255 bp
  • G to A, chromosome 18 at 37,696,580 bp
  • C to T, chromosome 19 at 3,267,276 bp
  • A to G, chromosome 19 at 34,675,179 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • G to A, chromosome 19 at 42,090,574 bp
  • A to G, chromosome 19 at 56,335,288 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7819 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045873-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.